Transcript

dhx8-201

ID
ZDB-TSCRIPT-130528-610
Name
dhx8-201
Previous Names
  • dhx8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058486 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058486|OTTDARG00000040637|ZDB-GENE-050809-39 dhx8|OTTDARP00000045720 dhx8-001 LG_ AL833789.20 Danio rerio protein_coding KNOWN, 4437 bp
AGTGCCATTTTCTTCCGGTGAAAAACAACAACATTGCTGA
AGATGGCAGAGATCGGAGAAGACGAGCTCAAAAAGCTCGA
ATATTTGTCTCTGGTGTCTAAAGTTTGTACTGAACTTGAC
AACCATTTGGGAATAAATGATAAGGACCTTGCTGAGTTTG
TAATCAGTCTTGCTGAGAAAAACACAGCCTTTGATGGATT
TAAGTCAGCACTGGTTAAGAATGGAGCAGATTTCACGGAT
TCACTCATCGGCAATTTGCTTCGTCTCATTCAAACAATGC
GCCCTCCTGCAAAAGCATCTACCAGTAAAGCCTCTTTTCC
TGCGGCTAAGCCAAAAAATGAAAAAGACAAGCTGAAAGAG
CTTTTCCCAGCTCTCTGCAGACCTGATAATCCTACTACCA
GGAATATGCTGGATGAGGATGATGTGAAAGTTGCTGCAGA
TGCTATGAAAGAGTTGGAGATGTTTATGCCCAGTGTTAGT
GGAACAGAACCTAGCAGCAGTAAACACAGATCTGAAACAA
GCAGCAGCAGTAGGAAGAAGCGGAGGAGCAGAAGCCGGAG
CAGAGATAGAGATCGGGATCGAGACAGAGATCGGGAGAGG
GACAGAGATAGAGACCGAAGGAGACGCCATCGCTCTCGCT
CCCGTTCTAGATCTCGTTCTAATGAGAGGGACAGGAGAAA
GCGCAGGAGCCGCTGGCACTCTCGCAGCAGATCCAGGAGT
CCAGCTCGCACAGACAGAGACAAAGGCTCAGACCGCTGGA
AGGACAAACATGTGGACCGCCCTCCACCAGAGGAGCCGTC
TGTGGCTGATATCTACAATGGCAAAGTCACCAGTATCATG
CAGTTTGGCTGCTTTGTGCAGTTGGAAGGACTTAGGAAAC
GCTGGGAAGGTTTGGTCCATATTTCTGAGCTTAGGAGAGA
GGGTCGTGTGGCAAATGTGGCTGATGTGGTCAGCAAAGGT
CAAAGAGTCAAAGTCAAGGTGTTGTCCTTCACTGGATCCA
AAACAAGTCTGAGCATGAAGGATGTTGACCAGGACACTGG
TGAAGATCTGAACCCCAACAGGAGGAGAAATGTGGGTGGA
GAAGGTCAGGAAGAGTCCGCTATGAGAAATCCTGACAGAC
CCACCAATCTTAACCTTGGCCATGCTCCTGAGGTTGAGGA
CGACACGCTAGAACGCAAACGACTAACCAAGATATCTGAT
CCAGAGAAATGGGAAATCAAACAGATGATTGCTGCTAATG
TGTTGTCTAAAGAAGAATTCCCAGACTTCGATGAAGAGAC
AGGAATTTTGCCTAAGGTAGATGATGAGGAAGATGAGGAC
TTAGAGATTGAGCTGGTGGAAGAGGAACCTCCATTTCTAA
GGGGACATACCAAACAGAGCATGGACATGAGTCCTGTCAA
GATTGTCAAGAACCCCGATGGATCTCTCTCCCAAGCAGCT
ATGATGCAGAGTGCCCTGGCCAAAGAGCGAAGAGAAGTAA
AACAGGCCCAACGGGAGGCTGAAATGGACTCCATCCCCAT
GGGCCTTAATAAACACTGGGTGGACCCACTGCCTGACGTT
GACGGCAGGCAGATTGCTGCCAACATGAGGGGCATAGGTA
TGATGCCCAATGATATCCCTGAATGGAAGAAACATGCTTT
TGGTGGCAACAAGGCCTCCTATGGAAAAAAGACGCAACTT
TCTATTCTGGAGCAGAGAGAGAGTCTTCCCATCTACAAGC
TGAAAGAGCAGCTCATTCAGGCTGTCCATGACAATCAGAT
CCTGATTGTTATTGGTGAGACAGGCTCAGGGAAGACCACT
CAGATCACACAATACCTGGCAGAAGCAGGATACACCACAC
GAGGGAAGATTGGGTGCACACAACCCAGAAGAGTGGCTGC
TATGTCTGTGGCTAAAAGAGTGTCTGAAGAGTACGGTTGT
TGTTTAGGTCAAGAGGTTGGCTACACCATCCGTTTTGAGG
ACTGCACTAGTCCTGAGACAGTCATTAAATACATGACGGA
CGGTATGCTGTTAAGAGAGTGTCTTATTGACCCTGATCTG
GGCCAGTATGCCATCATTATGCTGGATGAGGCCCATGAGA
GGACCATCCACACAGACGTGCTCTTCGGCCTTCTCAAGAA
GACTGTACAGAAACGAACTGACATGAAGCTCATTGTGACA
TCTGCCACACTGGATGCCGTGAAATTCTCACAGTACTTTT
ATGAAGCACCTATTTTTACAATCCCTGGTCGTACATACCC
GGTAGAGGTTTTGTATACAAAAGAACCTGAAACTGACTAT
CTGGATGCCAGTCTGATCACAGTCATGCAGATTCACCTCA
CTGAACCTCCAGGTGATATCTTGGTGTTCCTGACGGGTCA
GGAGGAGATTGACACGGCTTGTGAGATCCTTTATGAAAGA
ATGAAATCTCTCGGTCCTGATGTTCCAGAGCTGATCATTC
TCCCAGTCTACTCTGCCCTGCCCAGTGAAATGCAGACCAG
GATCTTTGACCCAGCACCACCTGGAAGTAGAAAGGTGGTC
ATTGCTACAAACATTGCTGAGACCTCTTTGACAATTGATG
GGATCTACTATGTGGTGGATCCAGGTTTTGTCAAGCAGAA
GGTGTATAACTCTAAAACTGGCATTGATCAGCTAGTGGTG
ACCCCCATCTCACAGGCTCAAGCTAAGCAGCGAGCAGGTA
GAGCTGGAAGAACAGGCCCTGGGAAGTGTTACAGACTCTA
CACAGAACGTGCCTACAGGGATGAGATGCTCACAACCAAT
GTACCTGAGATTCAAAGAACCAACTTGGCCAGCACTGTAC
TTTCTCTCAAGGCTATGGGCATCAATGACCTGTTGTCATT
TGACTTTATGGATGCTCCACCTATGGAGACACTCATCACG
GCCATGGAGCAGCTGTACACTCTGGGCGCTCTGGATGATG
AAGGTCTACTCACACGCCTTGGTCGTAGAATGGCTGAGTT
TCCTCTGGAGCCCATGCTTTGTAAGATGTTGATCATGTCT
GTCCATCTTGGCTGCAGTGAAGAGATGCTGACCATTGTGT
CAATGCTTTCAGTACAGAATGTCTTCTACAGACCAAAGGA
CAAACAAGCTCTGGCAGACCAGAAGAAGGCCAAGTTTCAC
CAGCCTGAGGGAGACCACCTGACTTTGTTGGCTGTCTATA
ACTCCTGGAAGAACAACAAGTTTTCCAACCCCTGGTGTTA
CGAGAACTTCATTCAAGCCCGATCTCTCCGACGTGCACAG
GATATCCGCAAACAGATGCTGGGCATCATGGACAGGCACA
AACTGGATGTGGTATCGTGCGGTAAGGCTACTGTGCGTGT
ACAGAAAGCCATCTGCAGTGGTTTCTTCCGGAACGCAGCC
AAAAAGGATCCTCAAGAAGGTTACAGGACCCTCATAGACC
AGCAGGTGGTCTACATCCACCCCTCCAGCGCATTGTTCAA
CCGCCAACCAGAATGGGTGGTGTACCATGAGCTTGTGCTA
ACCACTAAAGAATACATGAGGGAAGTGACCACCATCGATC
CAAGATGGCTTGTAGAATTCGCTCCAGCTTTCTTCAAAGT
GTCTGATCCCACACGCCTCAGCAAACAGAAGAAGCAGCAG
CGCTTGGAGCCTCTCTACAACCGCTACGAGGAACCAAACG
CCTGGAGAATCTCCAGAGCCTTCAGGCGACGCTAGCATCT
TCTCAGAAGGTCTTCATGAACTGCAAATGTCTGATACTGA
TGCTGAACAAAATATCAATTTTGTGTTTCTAGCAAAGTGG
AGGATAACATGGACAGAAGCTAAAAATGTGTTTAAAAGAC
TCGAAAATAATGTGCCCTGTTCTTTTGCACCACATGCTTA
AATTTATTGTAGTTTTTCCCCTCAAAAATTGAAATTGCCC
TTATTTTTTGCAAGGCATTTCATTTTTATATACATCTGTT
TTCTGCATGTGCTTCAGTAGGCATTGAGTCTTAGGGTACA
TTTGTGTATGATAATTGGATATTTAGCCTTGTGTTGTAGG
CCAAACAGTCCTTTTTTCATTAGTTATCAAGAATATTAGA
GCAACTGTTGTGCAGATTCTGTGGACGAGTCATGTGTGTC
ACAGAATCGGATGACGGCACATCTGTCTGGTCAGTGGATG
TTGATTAAAGAGCTGAGAGGGAAAGGATTTTCAATAATTC
AGTTAGTTTCTCTGCAGAAGTCTGGTCATAAACAAGTGAA
CAGGATGTTACGACTACTTTTTTTTTATCACACACGAATC
ACATCCTTATTTGGGACCTCTTTTCTGTTTTAATGTTTGA
ATTAAACAGCACACAGGATCAGTGTATTGGACCATTGTGA
AAATGTTGTATAAAAACTTTTATTACAGGAAGTGATGGGG
TGGAAATGTCCTGCAGTTTTTTGCTATCGTTTCTGCTTTT
GTTATGTCATACATCTTAAATTAAACTCTCTGTCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations