Transcript

zbtb4-201

ID
ZDB-TSCRIPT-130528-574
Name
zbtb4-201
Previous Names
  • zbtb4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058373 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058373|OTTDARG00000040594|ZDB-GENE-100318-5 zbtb4|OTTDARP00000047866 zbtb4-001 LG_none AL929346.6,CR925753.7 Danio rerio protein_coding KNOWN, 8887 bp
GAGAGAGAGAACACATCGCAGCCGAGATGCAGCAGAAGGT
TTTTCGAGGTTTAAGAGCGGGGTCATGGTGTCAGGAGAGG
ATGGCTGGGACCCTCTCCAGACCTGCACTGCGCTCTTGGA
GCTGAATGTGCAATACATGGCAATTCCCGTCCCGTTTTAT
ACCAACATAATCAAAGATGCAGAGTCTTATCTACATCTAG
GAGCTGTCGTCTCTGGGCTTGACCATCTTTAAACTACAGT
CTTCTTGATCTGAACCTTCTGTTCTCCACCATCCTTCAAC
TTCTGCACTAAAGATAGAGATAAAACAGACACTCAGAGTC
TTGAATTTTCCAGGATCTTGTTGGACAACAGAAAGACCCT
TTGAATGTCTAGTGCTCTGATTTAGACCAACTATAGCCTT
GGAGAGCATCTCAGAGGATTTGAACAAGGATCCAATGAAA
CACAGAAATAAGCACATTAGAGGAGACAGGATGGGAGAGG
GCACAGAGGAGGCAAATAGTGCCAAAACAACAAGGATATC
ACTTAGTTTTCCCCTTAGTGCAGGATTGCCTGGCTTTTCT
GCACAGAAGCACTGTTCCTCATCCCCCCCCACTTCCTCTT
CTGACGTCCATAGCAAAGATGGCTTAGATGGCACGGCATG
GATGGAGGAAACATATAGAGACAAACAGTTATCCAAAACG
TCATCAAAAACTGACCGTCTGCCATGCTCTTCCTCCTCCT
TCCCTGTCGATCTAACTGCTCCAGTCAGTAAGAACTGCAA
GTCATCTCTGTCAGTTTCTGTTGATGGTAGTGGTTCCAGA
TACCCAGCATCTCCTTTACAACACTCTAATAAAATGGACA
GTCCAAAGGAAACAGCTGGGGTCAGTCTCAATAATGGATA
CAAAGAGCATTCAACAACAGAAACAGCACATATCCTTTTC
AACCTTAGTGCAAGAGCCTACCAGGACCAAGGTGTAAAGG
ACCCAGAGAATTCAAAAGGCAAAAAACGCAAAGCAAACAG
CCTTCATGTTGAACTCAGCCTTCCTCTACCCAGCATCAAC
CCTCACTCTTCCTCATCAACTCCTCCTCCTCATTCGCCCT
CGTCTGTCTCTCTAACTTCCTCCCCCTTGACTCACCCCAC
AGCATCTTTCCATGACTCCTTTAGGGCAGTGCCGAAGCCA
GAACTACTGTGTGGGGTGTGTCACCGTCTGTTCAGCACTG
CATCGTCCCTCACTGTCCACATGCGTCTCCATCGGGGGGG
ACGAGTACTCAGCTGCCGACACTGTGGCAAAGCCTTCATC
CATAATAAAAGACTGCAATCCCACGAGGCCACCTGCAGGC
AAGGACTGCCAGCTTTTCCAGTGCCACCCAAAGAAGAGCC
CCTGGAGGAGGGTGAAGTGGAGGGGGAGAGAACAGATGAG
GCTGCAGAGCCAGAACAGCTTGGACAAGAAACAAGGCCTG
GCCAACCCGCAAAGAAAGTGCGAGACCTTACAGCCCGTCA
TGCTGAAGCACTGACATGCGGGGATACCCTGGGGGATGAC
GATCACTTTGTTAAAGTGGTGGATGGACATATTATTTACT
TTTGCTCAGTGTGTGAGCGCTCTTACATGACATTGTCCAG
CCTGAAGCGACACTCCAATGTGCATTCCTGGCGCCGGAAG
TACCCCTGTCACTTCTGTGACAAGGTTTTTGCTCTGGCTG
AATATCGTACTAAACATGAGGTGTGGCACACTGGTGAGCG
ACGCTACCAATGCATCTTTTGCTGGGAGGCATTTCCTACC
TACTACAACCTTAAAACACACCAAAAGGCTTTCCATGGCA
TAAATCCAGGCTTGATCTCAAGTGAAAAAACAGCTAATGG
TGGCTACAAGCAGAAGGTCAATGCCCTTAAACTTTACCGC
CTGCTGCCCATGCGATCCCTAAAACGACCTTACAAAACCT
ATAGTCAGCCAATGGCTGATGGACTACTAACTTCTGACTC
AACTGATAACCTGCATTTGTCTGTAGATGGCAGCCTCCCA
CAACCATTGGACACAAAGAAATTGGAGTCTTTCCTGAAAG
ATCTTCAAAACCAAGACATCAAGGCTGAGACTGAGGGATT
CCCCATCAGGTTGGACATAGAGCAGGGTACAGAAATAGCA
TCTCCACAAACAGATATGACACTAGAAGCAGGACAGGTAG
AGGATTCAGATTTGTGGCCATCAGGTAATAACAACGACAA
AGGCCAAACTCCAAAGTGCCCAGAAAGAGCTGTGTCTTCA
GTCATAGCATTTGCACGCAGTAAACCCTCAGTCATCATGC
ACAGCACTGCAGTTTCTTCCTCTGTCATTGTTCACAGAAA
TAAGACAGACTCTGAAGAGAGAAAAAGAAGTCCAGAAAAG
CATCAACTGGCAAAGACAATAAAAAAGCATAGCCAGAAAG
AGCCAACAGAGGCATACAGGGAGTGGAATGCTGTCGGTTT
AGACCCAGAGGTCTCAAAAATCAGACATCCAACGGAGAAA
CTTCACAAGGGACGAAAAGTTCACCATAAAACAGAGTCAA
GTAAAACAATACCTTTAGCGGTGGGATCAGAAGTCAAAGG
GAGTGGTCCACTTTGTCAGATAACTGTGCGCATAGGGGAG
GAGGCAATTGTCAAAAGGAGCATTTCAGAAACAGATCTAA
GAAGAGACAAAAGCCCTACACGAAGCAAACCTAAAAAAAG
TAACCTCTTACAAGACAAACAGAGAGAGCAAAGACACACC
CATCATCACCAACGTAAACATCGCAACTCCAATCAGGAAG
GAAAGGAGAGGGAGCCCAAAAGGAAAAGCTCTAAAGTGAA
AACCAAAGTGAGGAAATACTTCTTCCGGCAGGAAGTCAGG
GAGGACAGAAATGACCATGATGTAGAGGACAACCTTTGGA
GGCCTTATTATTCTTACAAACCTAAGCGAAAGGCTCTTCA
TATACAAGGAGCTAAAGCCTGGAAACGCAAAATGCACTAC
AAACGATCCCTGAGGCCTATGAGGAGAGCTGAAAGACTCA
TGAAAAATCATCTGAATAAAGATGCTGAGGATGAAGATGC
AGATGAGAGAGAGGAAAAAAGGCAGAAAGAAAAGACAGAA
CAGAAGGAGGTTAGTGATCCAGTAAAAACTGAAGTCAAAG
AAATGCCACACTCTTTCCCTGTCTCTTTAAGAACAGAACA
GAAGGAAAAAGAAAAGGGAACAAATGGAAAGCCTAATCTC
CCTCTCCCTTCAACTGTTCCTCAGGCTACACCTAATCCAA
CACACACAGCATCTTCTATCATCAAGCAACGATGGTCAGA
AGATCAAGCCTCTGAGTGTGGAACATGTGGGCGCTGGTTC
TCTAGCCCAAGGAAACGAGACAAACATGAAATGACACATC
TGTTTGAGTTTGTATGCATGCATTGCAGAGCTCCATTCCC
CTCACAGTTTAAGCTAGAGGAACATCAGAGAAGTCAGCAT
CCCAAAAACAAGCCCTTGTCTGCCCCCACTTTCTACACTT
CACAGTCATCAAAAGGTGAGGTGGAAATGAAAGTGGCTGA
TGATGATGGAGTGAATGGACGGTCCATTGAGAAAGGCAGC
CCAGTTCGCTTGGGCAGGAGACCTTTAATTAGATACACAT
GCTCAAAATGTGATAAGGTCTGCAAAACCTCTGCTGCACT
TAACTGCCACCTCAAGCGACATGAGTTAGGGAGTTTAACA
GAGGTTGAAGATGCACATGAAAAGCAAGACATGCCAAGTT
ACACACCTCCTGCAGTGGACACTATACCAAGCTTAGGTTT
AGACACCAACTGTGAGCAAGTACAGCCAGTGTCTGTCATA
TATTATTCCAAACCAGAATGTCAAAACACCGATAACGAAC
TGGGTGAGAAGATGGAAGAACACCAAAGAGTCAGAGATTG
TGAAAGCCCTAAGGTGACAAAGAATGAAAAAGTTCACAGT
CCACGGTGTGCACAGTTTTCCCAAGTTATTCACAGCCCCA
CTTTAGAAAGATTTAACGTCATTTCTCCAAACCTCCCTAG
TGTTTTGGTAATGAATGGTGCAGAGTGCCTAGACTACAGG
ACACCAGAAAAGCAAAATTTAGAAAAACTAGATCAGCAGA
AAAGAAGCCAGACACCAAGTAACAGACAAATCCAAGTTTC
TCAAATGCTGACAGAGCCTCAGATTAGAAGAGAAACAACT
CCATCTGTACCAATATCACTAAAAACAGGCAGAGGTTATG
CATTTACAGACTGTGACAAAAATCCAAATCAAGATTTCAG
TGATTTACAAGATGCTCAGGATCTAAGAATCTTTCCTCAA
TCTAGCAGCCAAGCCCAAGACTTATCCATGCCAACAACAC
TGGCAAAAAAGAGGGAGCTTGATGAACAGATTAAACATCC
ATCCAACATCTTAAAAGCCCAGTCTTGTAATGAGGAGGTG
TCATTGCTAGTGCCCAAAGAGGAACCACTCAGTCCTATTC
CATCTCCCACATGCTCTGTCATTCAAACCACTCCTAAAGG
TCTTTCTCAAAGGTATTCAAAGTCAACGTGTCACTCTCCA
GAACCTCTGGACCTACAGTTGCGACCACAGTTGGATCATA
ACCAATCACACAGAGGAAGACACAACTCAGAAAAACAGGG
TCTTATGTTGCCAGCAAATTCAGCTGGGATAATCGATCCT
TCTTCCCCCGCCCTGCTAAATCCTCAAGTGCCCGCAGCAG
AGCCTGAATTAAAAGACATCACCTCTGGTACTCATACAGA
ACACCACAGGGTCTCGGGCTACCCTGTGCAGGAGTATTCT
CTTCCAATGGTTATTCCTGGAGGGTACTGTTCTGGTAAGA
ATCAGGAGGAGCAGATCCTGATGTCTTACCCTGCTGGACC
CCTACCATTTCCTCCACTTGGGAAAATGGTACCCCATGCT
GACTCCACTAAACTGCCCTTTTACCCCGACCCTTATCACC
TACTGTATGGCCCACAGCTACTGCCATACCCTTATAACCT
TGCTGCCCTTCCAATGGCTCTAAATATGATGGCATCAGGG
GACAAAGAGCCCTTGCCCTTCTTGCCTTTTTTTAATTATG
CCGCCGCAGCTGCCCCTTTAACAGGCACATTGCCCCATCC
TTTAGTGATGAACCCCAGCCTATACAACAGTGGCGGCAGC
AGTAGCACAAAGCAGGACAACCCATAAGTTAGTAAACAAT
GGCAGCAAGGGAATACTGTATAAGAGCAGAGAAGGCCATT
AAGGGTGGAGATTATGTTTTTTTTCTGTTTGTTAACCAAA
CACTCTTGCACAGCTCTTGTGTCTTTTTTGTAAAGCAGCA
AATGTATGGAGATTCATAGGAATCAGATGTGGTGGAATGA
TGGAGAGTGTCTTGAAGACAAAGAAGAAAGGATATGAGGG
GGTGAAGAACAAATAATATAACGCCCCCTTTAGGCACTGC
CAAGATGCACCTCCAACACACCACCCTTTTGCCTCTTCTG
TAGTGTTGATAAAGCTGGGATCTCCATCCTCTCAGAGCCA
TTACGATATCAGAGATAACGTGAACAATAACAGCTAACAG
GATGTGTGTTTTTCTAAATGAATTCTGTCTGCTTCCCATA
ATAGGGACAGTATAACAACAATAATGATAATAATAGTTGT
GTTAATTATACTGCTTATACAAGGGTGGCTTATCATCAAA
CGCTAAATGTTACGCCTGAAGTGGCTCAACATACTCAACA
CACAGGGAAGGAAGATGCAGCAGCATTAATGTGTGTGCGC
ATGAGTGTGTACAATGTGTGAATTTGTATAGAGGTAATGC
ATGGAGAAATTGGGGTAGCTCAGTGTCATATCTTACAACA
TCAGTACTCCAGTCATGTGTTTTCCAGTATTTCGGCTTTA
TGTGTGCCTGCAGGTTTGTGTAAGTGTATTTGTGGGGTGT
GTTGGGGGTGTAGGCATGCACACTTAAAAATCATACGTGC
TGCATCAGCCTTGGCCAGGTCCTTGGAAGTTCACATCATT
CCTGGGAAAGCTGTTATAATCTTAATAGGTCAGTAAATAG
AAAACATAGATGAAGTTCTTCTTTCTTAAGTCATAGCATA
GCAACTTGATGGTGTAGCTACATGTCATATGGATAAAACA
TATTATGTGATGCCTTCACTAACCAGGGTTATCATGACAA
GATCAAGTGTATGGTGATTTAGAATACACTCTACATTTGC
CCATGTTATGCCTAGAGACAGATTCCGTTTCACATAGTGT
GGTTTGTAGGATGTGGCTATTAATCCTTGATCATTTATAA
AATAAGTCTGTGTACTTCCAGTACTCCTGCCAGAAGTTTC
ATCTCTTCCAGCAACAGTCGACTTCATGTTAGTGGCCTTC
TCCTCCCCACTGCCCCCTGGTGTCCACCAAAGACACTCCA
TTCACTTGACTTGATTTGAGATGCGATAGATACAGTGAAA
CCAAGTGAAGAACAATATAGCGTGAGAGCGTGAGCTAAAA
TAGGAGCAAAGTGGAGAAATGCGTAGACGTGGAGTATGTT
AGCACAACGGAGCTTCCTTTGTAAAGAGAATAGAGGCGGT
AGTTGGAGAATGTTAGGTTTAGCAAAACAAAATCTACTAC
GTAGAATCAAGCCACCATTTCTGTTGGTGTTTCTGTTGGC
AAAGACAGGGAGAGGACGTCAGTCGGTTCTGACTCCCTGC
AGGGCCTGCACTATGGGACTTATAGCACTGGAGTGGCTTA
AGCTCTCCCTTGTTCTTTCTTGTTTTTTTTTTATTTTGTT
TTACACTATATTATGTTTGATTGACATATTTTCCTATTTT
GGTAGTGAGACAAGGCTTGTACTCGAAGCTCGTCAAGTAC
ACAAGAATATGAATGTAATTTAGTCATGAGGTTAAAAAAA
TAAAGACAGTATGGTAGATCATTTCTGTATGCTGACTTGA
AAAATAACATGTAAAACTGAACCGCTATGAGGTATTCATA
TACATATATATCTATATATATATACAGTAGTCATAGAGAT
ATGTCAAGGAAGTTGGATTCAATATAACCACAACGCATGA
GCAACAATTGCTTCTACAGTATCTTCTGGTGTTGTCACAA
AACTCCATTTACCTTCATAAGTGGTTCTTCATTATGTTCT
GCTTTTTTTCTCTCAAGACACGTCCTGACAAAAACTTTTT
AACCCCTCAGTATCAACATTTCAACTTTAAAACCAAAAAG
AAAAACTCCTATGTTGCCTTATTTCTTTTCCCCAAGCATC
ACGAAAGCTTTTCAAACACCACCCTTCCATCTCCAGCTCT
CATTCCAAAATCCTCCATTTCCCCGTCGATTCTCGATATT
TTACCTTCTCCCTTTGAAGTGAGTGTGAAACTGTGCAATG
TAGCCGCAGCACTGTTTATTTCCTGAGGGTTAAACACAAT
GCAATGAACGGTTGTGGATCATGTAGCTTCACTCGGGTGT
GAGTACAAGCCTTTTGTTCGCATTGTAAGACTGTGTTTGT
GTGTGTGAAAGAGAGAAAGGGTGTGTGGTGGTGAAGGAAA
AACCAAAACAAGGTCTATCTCCCTTGATAGTTACCAACAA
ACTTGTGTTTGATTTTGGACCTGTTCTTTTTTGCTGTGTT
TTCTCCACCACAAAAATGTTCGATGAATTTTAGAGATATG
TAAATTATGTCACCTACCTGTACCAGTCATTGGCAGCAGA
TGTTCAATTTATGTAAACGAATGTACAAATTGTGGTGAAA
ATGTAACAACTATTTTCAGAGAATGAATAACATTGGCTTT
ATACATTTATTATTATTTTCTGACCTTTTTTAAATTATGT
ATTTAACTCTGAATGGATTTACATATTCGCCCAAATTTAA
AATGCTAAATTCTGAATCAGTAACTGGTTAAAATGACTAA
ATCTAAAATTCTGATGTTTACATACAAGATGCCTTTGCAT
TTCCTTTTATTTAAATAAGCTAATAAGAATATGCACATAA
TCTGAATGCACCTTACAGAAGCAAAATTGTGATACCATTT
TCTATAAAACACTTTATTTAAGTTTTACTTTTGGGGAACA
TCAAAATGAGTTATGTTCTTGTGTTCCTGTTCATCCATCA
GCAAACGTTCAATAAAATTCAGTGGATAGTACGCTTAAAA
GAGGTCACTTGTGACTGTGTGGGCTACTACTACTATTACT
ACTACTACTACTAGTCCTACTTTAAAAAATATATATATAT
TTATGGGTCAGCATCTGGATAGACTACTGAATATTTGCAC
AGACCAATTAAAAAACAAGCTTTTTGGGGGGCATGTGTAC
TGAAATAATCCCAGATTTGTTCAGTATGTTTGGTTTTGAA
CAACACATGAATACAAAATATCAGCTTGGTCCACCTAGAA
CAAAGAACCTTTAAAGCATAAGTATCAAGCTCAATTCCAG
GAGGGCCGCAGCTCTGCACAGTTTTGCTCCAACCCTGATC
AAACAGTTGATTCAACTAATGAAGGTGTTCATGACTCTTT
TGAACACCTTGATTATTTGGATTAGCTGTGTTTGATCAGG
GTTGGAGCAAAACAGTGCAGAGCTGCGGCCCTCCAGGAAT
TGAGCTTGAGACCTATGCTTTAAAGGCTTCAATTTTCAAT
CCAAATCTACCAGCTGCATATGTTCTGCACTTGGTCATAG
TTGTAGGCATGTGACTCAGTCGTCTGGTATTTTGTGACAA
TGTTATATTGTGCCATTGTTTTAGAGGTCCACATTATATT
TGGGCAGTTTCAAAGACGTGAAATGTTTGAAAACTTTTTT
TGTGTCTTGTTGACTTTGTGACCATTTAATACAGAGGTTT
GTTGGCACACGTTGCCAATTCAAGTCTACAATCTGCAGTT
CATTTTTTTTTTTGCTCTTGTTCTCTTTACTCCCTCTGTC
CACACTACAACCATACAAATAAAGTATTAACCTGATGACG
TGCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations