ZFIN ID: ZDB-TSCRIPT-130528-515
Transcript Name: si:dkey-66i24.9-201
Previous Names: dkey-66i24.9-001, si:dkey-66i24.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049861 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049861|OTTDARG00000035078|ZDB-GENE-130531-63 si:dkey-66i24.9|OTTDARP00000039120 DKEY-66I24.9-001 LG_ BX004999.8 Danio rerio protein_coding PUTATIVE, 2455 bp
ACACAGAAGAAAAGGGAGTACGTGCGCGCGGTTTGTTTGA
CTTCATGTATATTTTGTGATTATTTTGTAACGTAAACTTT
GTAATACCTGTTGTTTTACCTACACCGACAGGTTTATCTT
AAACCAGAAAGATACAGATAAGGACTAAAACTAAAAATAG
CGTGTATATAACGTTAATATATCCACGTGTAACTACAAAA
GTAAGATCTGCTACTGTAACTGTTAAAGATGGCTTTTGTG
AAGAAGGAAGAAGAGGAGGAGGAAGCGTGTTATCCTCAAC
CATGTTGCATAAACGATGAAAAACATGCAGGAGTGATAAA
AGTGAAAGAGGAAGTCCAAGATGAGAATGAAGTGGAGGAG
AAATATCAGCCCCAGAGTTTTCAAGATGCCATAAAAGAAG
AACAATCATTGTCTTCTTCCCAAACTGAAGACACTTCCTC
ACAAAGCAGCGCTCAAATAACAAGAAGGCCTCAATGTGGA
AACACTCTCGCACATACAAGAAACTCGACCAAGCAAGTGA
CAAGTGACAAACCCTCAGAAAACCACAGTAGAACGGGCCA
GTTCACATGCAACCAATGTGGGAAGACTTACGTGTATAAA
TCCAAATATGATCAACACATGCAAATCCACACTAACAACA
TTTTCAGCTGCTCTCTTTGTGAAAAGAGTTTCATCTATAA
AACTCAGCTGGACATTCACATGAGAGTTCACACCAAAGAA
GAGCCCTACACGTGCCATCAGTGTGATGAGACTTTCAGAT
GGAGCAACAGCCTCAAGTATCATCTGCTGCGTCATCATTC
TGAAGTGCTGCAGTATAAATGTGATCAATGCCCTAAAACA
TTTGCTAAAGCGTCATACCTAAAGACTCACCTCAACACTC
ATGCGGAAGAGAAGTATTGTGATTGTGCCGCTTGTAAAAA
GAGATTCTTGCAGTCAGGAAAGGCTGGAGCAGTGAATGCT
ACAGGAGTTTCACACAAAAAGAAAAACACATTTACCTGCT
CTAAGTGTGGACAGGTTTTTACGTGTAAAAGACGGCTTGA
TAAACATATGGTGAGTCACGATAAAGGGACGTGTGCGCAG
TGTGGAAGGATGTTTGCCACCCTTCAAACCCTTAAAATGC
ACATGAGAGTTCACACTGGAGAAAAGCCATTCACCTGCTC
TCAGTGTGGGAAGAAGTTCTCTCATGATGGAACCTTTAGG
AGGCACAAATTAAATTGCCATCAAGATGCGCAAGCTGTTT
TACCTGAGAAAAAGATTCCAAAATCCAAACGCTAAAGGTT
ATCAGGGCCCAGTTTTTCAAGAAATTAAATTTGGATCAAA
TTGGTCAGGATTTGGAAGTCCCATCTTTTGCTATCCAGGA
TTAACTGATCTATCTTGCTTTTATGACAGTTTTTAAAGGA
ACATTGGGTTGGCTCACTGTGATCCAAATACCAAACATCA
GGATTACCAAATCCTGTTTTCCAGAGGCTCAAATGGAACC
AACAGTGTAGCCTACTGGCTTAGCAAAGAACAACAGGTAG
GCAAAATACCAGTGCTCACAAACAGCCATTGTTTGTTTTA
ATGGTAAGAAACGGAAACGCTGCTATTAACAAACTTTCGA
CATTTTTTTAGTTTGTTCTTATGCAATACTGCTTTCATAT
TAATTTGTTGTTTACCATATCTTATTAGATGTAACTTGCT
TCATATAGGCTTTAAATATGAAGGAATTCATATATCATCA
GCAACCAAAAAGTTTGTGAGCATTTCACTTAAAAAATACA
ACAATTTGTTTTTTAAAACCAAATAAAATTAAAAATTACA
ACTGAATCCACCCTTCTGATGTAATCAGGATAATCCTGTA
TTTTTTTTTTTTTTATCAAATAGATCCCAATCTGAGTTCA
AAGTTGAGTGACCCAAAGGGCAGGTATGATCTAAATCAAA
TGTAAGATTGGATTACATGGTCTGATCTTAATTCAGAATC
CCTCTGTTATTTTTGAAAAACCCGTTTCCAAGATCTACGT
CCCACTGGATTACTTTTGAAAAAAAAAAAAAAAAAAAAAA
AACTGGGTCCTGATGACATATCCTTAAACTTATCTAGGTG
AATCATGTAAATTGCTTTCTGGAATACCCCCTGGTTCAGT
GTTGAGGTTACTGTCTAAAAAATATGCTGGATAAGTTGAC
TGTTCATTCCGCTGTGGTGACCCCTCATGAGTAAAGGGAC
TAAGCTGAAGGAGGACGAGTGAATGAAAATAAGAAAATAA
ACAAATGTACGTACATCAATATGTATTTTCAATTGATAAT
GGTTGTACTGTTTTGTTAATGGTGTTCTGTAATTTACTTG
TACTGTGGTTATGAACGAGTATGTAAAAGGAAATATGGCC
ATTTTAACTTTGGAACTTTGCAATGTTTTGTTTTGTTTAT
GGAGTAAATTTTTTTGATGATTATATCAATAATAAAGTTT
TTTTTTTTATTCCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-66i24.9-201 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049861 (1),  Ensembl_Trans:ENSDART00000153074 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH583440 (1) 889 nt
GenBank:EH600862 (1) 782 nt
GenBank:CF997765 (1) 770 nt
GenBank:CT630046 (1) 642 nt
CITATIONS (2)