Transcript

si:dkey-66i24.9-201

ID
ZDB-TSCRIPT-130528-515
Name
si:dkey-66i24.9-201
Previous Names
  • dkey-66i24.9-001
  • si:dkey-66i24.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049861 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049861|OTTDARG00000035078|ZDB-GENE-130531-63 si:dkey-66i24.9|OTTDARP00000039120 DKEY-66I24.9-001 LG_ BX004999.8 Danio rerio protein_coding PUTATIVE, 2455 bp
ACACAGAAGAAAAGGGAGTACGTGCGCGCGGTTTGTTTGA
CTTCATGTATATTTTGTGATTATTTTGTAACGTAAACTTT
GTAATACCTGTTGTTTTACCTACACCGACAGGTTTATCTT
AAACCAGAAAGATACAGATAAGGACTAAAACTAAAAATAG
CGTGTATATAACGTTAATATATCCACGTGTAACTACAAAA
GTAAGATCTGCTACTGTAACTGTTAAAGATGGCTTTTGTG
AAGAAGGAAGAAGAGGAGGAGGAAGCGTGTTATCCTCAAC
CATGTTGCATAAACGATGAAAAACATGCAGGAGTGATAAA
AGTGAAAGAGGAAGTCCAAGATGAGAATGAAGTGGAGGAG
AAATATCAGCCCCAGAGTTTTCAAGATGCCATAAAAGAAG
AACAATCATTGTCTTCTTCCCAAACTGAAGACACTTCCTC
ACAAAGCAGCGCTCAAATAACAAGAAGGCCTCAATGTGGA
AACACTCTCGCACATACAAGAAACTCGACCAAGCAAGTGA
CAAGTGACAAACCCTCAGAAAACCACAGTAGAACGGGCCA
GTTCACATGCAACCAATGTGGGAAGACTTACGTGTATAAA
TCCAAATATGATCAACACATGCAAATCCACACTAACAACA
TTTTCAGCTGCTCTCTTTGTGAAAAGAGTTTCATCTATAA
AACTCAGCTGGACATTCACATGAGAGTTCACACCAAAGAA
GAGCCCTACACGTGCCATCAGTGTGATGAGACTTTCAGAT
GGAGCAACAGCCTCAAGTATCATCTGCTGCGTCATCATTC
TGAAGTGCTGCAGTATAAATGTGATCAATGCCCTAAAACA
TTTGCTAAAGCGTCATACCTAAAGACTCACCTCAACACTC
ATGCGGAAGAGAAGTATTGTGATTGTGCCGCTTGTAAAAA
GAGATTCTTGCAGTCAGGAAAGGCTGGAGCAGTGAATGCT
ACAGGAGTTTCACACAAAAAGAAAAACACATTTACCTGCT
CTAAGTGTGGACAGGTTTTTACGTGTAAAAGACGGCTTGA
TAAACATATGGTGAGTCACGATAAAGGGACGTGTGCGCAG
TGTGGAAGGATGTTTGCCACCCTTCAAACCCTTAAAATGC
ACATGAGAGTTCACACTGGAGAAAAGCCATTCACCTGCTC
TCAGTGTGGGAAGAAGTTCTCTCATGATGGAACCTTTAGG
AGGCACAAATTAAATTGCCATCAAGATGCGCAAGCTGTTT
TACCTGAGAAAAAGATTCCAAAATCCAAACGCTAAAGGTT
ATCAGGGCCCAGTTTTTCAAGAAATTAAATTTGGATCAAA
TTGGTCAGGATTTGGAAGTCCCATCTTTTGCTATCCAGGA
TTAACTGATCTATCTTGCTTTTATGACAGTTTTTAAAGGA
ACATTGGGTTGGCTCACTGTGATCCAAATACCAAACATCA
GGATTACCAAATCCTGTTTTCCAGAGGCTCAAATGGAACC
AACAGTGTAGCCTACTGGCTTAGCAAAGAACAACAGGTAG
GCAAAATACCAGTGCTCACAAACAGCCATTGTTTGTTTTA
ATGGTAAGAAACGGAAACGCTGCTATTAACAAACTTTCGA
CATTTTTTTAGTTTGTTCTTATGCAATACTGCTTTCATAT
TAATTTGTTGTTTACCATATCTTATTAGATGTAACTTGCT
TCATATAGGCTTTAAATATGAAGGAATTCATATATCATCA
GCAACCAAAAAGTTTGTGAGCATTTCACTTAAAAAATACA
ACAATTTGTTTTTTAAAACCAAATAAAATTAAAAATTACA
ACTGAATCCACCCTTCTGATGTAATCAGGATAATCCTGTA
TTTTTTTTTTTTTTATCAAATAGATCCCAATCTGAGTTCA
AAGTTGAGTGACCCAAAGGGCAGGTATGATCTAAATCAAA
TGTAAGATTGGATTACATGGTCTGATCTTAATTCAGAATC
CCTCTGTTATTTTTGAAAAACCCGTTTCCAAGATCTACGT
CCCACTGGATTACTTTTGAAAAAAAAAAAAAAAAAAAAAA
AACTGGGTCCTGATGACATATCCTTAAACTTATCTAGGTG
AATCATGTAAATTGCTTTCTGGAATACCCCCTGGTTCAGT
GTTGAGGTTACTGTCTAAAAAATATGCTGGATAAGTTGAC
TGTTCATTCCGCTGTGGTGACCCCTCATGAGTAAAGGGAC
TAAGCTGAAGGAGGACGAGTGAATGAAAATAAGAAAATAA
ACAAATGTACGTACATCAATATGTATTTTCAATTGATAAT
GGTTGTACTGTTTTGTTAATGGTGTTCTGTAATTTACTTG
TACTGTGGTTATGAACGAGTATGTAAAAGGAAATATGGCC
ATTTTAACTTTGGAACTTTGCAATGTTTTGTTTTGTTTAT
GGAGTAAATTTTTTTGATGATTATATCAATAATAAAGTTT
TTTTTTTTATTCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations