Transcript

armc5-201

ID
ZDB-TSCRIPT-130528-514
Name
armc5-201
Previous Names
  • armc5-001
  • dkey-66i24.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049858 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049858|OTTDARG00000035075|ZDB-GENE-030131-7382 armc5|OTTDARP00000039117 DKEY-66I24.6-001 LG_ BX004999.8 Danio rerio protein_coding NOVEL, 5335 bp
ATGTCTTTAGAACAAGGACTTAAACTAAATTTAAAAAGTT
CACACTGCGCCTCAGAGGCGTCCACCACTCTCCCAGAATC
CTCTCTGACCTGGTGTTTGGCTCAGCTTTCCAAATCAAGT
CTATTAGCAGACAGTGGACTGACAGGAGCTGACAACAAGG
GTGCCGCAGGAGGAGATAAAGCCAGGGATGCAGACAAGAG
ACTCAAAGCTGGTCAGTGGAGGGCACTGGTGGCCATTCGG
ACACAGCACATCAAGGGAGGAGGCAGCAGGATCGCACGCT
ACCAGTCACGGGGAGGAATCCCTCCTTTGCTCGATCTCCT
CAGGCGACCAGAAAGCTCCAGGAAGTTTGTGGACCTGGCA
CTGAGCATCTTGGCCAACTGCTGCACTGAAAAGGGGACCA
GACTACAAGTAAGAAAGCTGGATGGCGTATCTGTTGTTGT
GGATGTCCTCAAAAGAAATGTCTCTGTGGAGACTGTACAG
AATCGAGCAGCACGAGCTCTGGGGAATCTCGCCATGGACC
CAGAGGGCTCTTCTGAGGTCCACTCTGCAGGTGGTGTTCC
TCTTCTCCTGCTCTGCCTCTCTGTCTCTCCTCCTCCTCCT
CCATCCTCTCCCTCTTCAGTGACTCCAGCCTCTGAACTCT
GCGCACCCAAAGTAGAGTGTGTCCAATCTGCCGCCCGGGC
TCTTGTCTACCTCTCCGACACCCCTGCCAACCGCCTCCTG
CTGCTTTCCCAAGGAGCTCTTCCTGCACTTGCTCAGTTCA
TTTCTCCAGAATACCCCGCAGGTCTGCAACGGGCGTCTCT
GCGCGCCCTTCATGAGCTCACCAGAGGCTGCAGTGCGGAG
TGTGCCAGAGAGATGTCCCGCTCTGGGGCTTTGACTCAGC
TCGGGGTTCTGGCTTCGGGAGAAGACGGTCGGCCTTTGGA
AGAGCTGGCGTTGAAGACTTTGGCTAATATGTGCTCTCAA
GGCAGCCTGAGGCCTCTTGTGGGTTCGTTGGGAGTCATTC
AGAAGTTTGCAGAGGAGGTGAAGAAGGACCCTCTGAGGTC
GAGTGTGTTTTTTAAGGCCTTGTGTTTGTGCTGCAGGGAA
GCTGTGAACAGGGCTAAAGTAAAAGAGAGCGGAGGATTAG
AGGTGCTCATCAGTTTTCTGTCGGCTCATCAAAACCATCC
GCTCACGCGCTTTGCATTTCTAGCTTGTGTGGACTTCGTT
TATGATGAATCGGCTCTCGAGCAGCTGCAGGAGCTCGGGC
TGGTGCCGCTGCTCATCAAGCGTTTAGTGGAACTTGCTCA
AGGAGAAGAACCAAACACTGGGAAGATGGATGCCAGCCTG
GCTTCTAGTTCTCCATGCTCTGAACTCATGAGCTCCTGCT
TTAATTCTTTTGACTTCTCCGCACTTGAAGGAAACAAGAG
GGAGGATGTGAGTAAAGACCAGACGGCAGGATCCTCCAGC
TTCCTCAGCCTCAGGTCTTGGCTGGTGTCGGAGGGTCTGA
TCTCGTCTGAGGGTGAGCTGACTGAATGCCCGAGCGGACC
TGATGTGTTTGGTGGCAGCCCTCAGTCCTCCGTCTCATCA
TCACCACTGCTCACACACTGCCCTGACCTCTCCCTCACCC
CAACTTTACGCCCACCACACTTCTCTCCCTCATCTCGCTC
CAAACTCACCCGTCCTGCCTCCTCATCCGCTCCAGTATCT
CCTCGAAACATACCAGGGTCGCCTTCCTCCACACAGCCCT
CCTGCACCTCCACCCCTCAAAATGAGCAACCGTCATCAGT
GACCAAACCCTCCACCACCCCCTCATCTCCCCCCCAAATA
TCCTCTCCCCCCAGAAAGAGGCTCCGTGCAGCTTCATCCT
CATCTTCATCCTCCTATACATCATTCTCTTCATTTTCATC
ATCATCCTCCTGGTCTACTGTGGTCTCCATAGAAACCCCA
CCCATGATGTCAAAACCCCCAATCTATAATCACCCGTATC
ACCCTGAAGTCTGGGCCCCAGAATCCCCCATTCTCCTGCT
GCTGTCCCGCTTCTCTCATGCCCCAGACCCCAGCACAGCG
CTCATCAACACCAGCGTTTTCTCCGGGCTCTTGTACTACC
TCACCCAGCACCATGACCCCAGTGGCCGGTGCTTTCGGAT
GCTCGGGAGGCTCAGCTGTAACCCAAACTGCTTGCAGGCT
CTGGTCAGAACTGGAGCCGTGGCTCTGATCCGACAGAAAC
TGTGTGTGAGAGGAGACGAGGCTGGAGGAACAGACAGACA
GTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAGGTTTG
GGTCTGCTTAGTAATCTGAGGGTTCAGAGTGAGTCTGGTT
TTGGCACTGGAGTTCTTACACACATCATGCTGTCAGGATC
TGAATCTGACAAACTGTACTGTGTGCTTTCCCTGCCACTG
GTTAACAGCAACCGAGTTCTTTTGAAGAAGCTGCTTCTGG
ATAGCGGTGGGCTGGCAGCAGCTCTCGAACTGATTGATTA
TCACAGTGAAGATGTTGATGATAATGAAGATGGACAATCT
GACAAATGCAGGACGTTTCTTGCCGGCTGGTTGCCTCCAC
AGGAACAAGTGTCCTCTTTGAGATGTAAGTCGCTTTACGC
GTCTCTTCTGATTGGCTGCCTCTCCAGTCTGCTGTCAGCT
TTCAAGGAAGACAGAAAGAACTGCAGCACAGATTGCAGGA
CCACCACGGAGGCGACTCAAATTTTGCACAACAAATCCCA
ACTGCAGCAAAACCAACCATGTCCCTATCAGAAGGCAACC
CATAATCTAACTTTCCTCCTAGATGATGGGACCCTTCTCA
AAGCCAATCACGAGGCTTTAACCGGGGAAGAGGGAGACAG
CGGTGTTGGGTCTGAGTATTTCAGAGCACTCTTGATGGGA
GGATTTGGTGAGGCTCAGAAAGATAAAGCTGAACCCATCC
AAATCAAAGATGTCAAAAAGGGGATGCTCTTACCAGTTCT
CCACTACCTACATGGCTGTCGTTGGACTGATGGAAATGAA
GATCACGAGAAGTCAAAGCAAGATACACATTGTCTTGTTT
TGTCCTCTCTAGTCTCCACAGGGTTTGCAAGACCACAGGA
TCAATCAGCGGAAAGGGAATTTATGAAATCCTCATTGGCC
CAAGTGATGATTGGTGCTTGTAGGTTTTTAGTGCCTGGTT
TACAGCAGGCAGCTGAAGATCTGTGTGTTGGCCTTCTTTA
CTCATTCGTAAGACGCCTGACCACATTTTCCTCTTTGAAT
AAAACCACTACTATGACCAGTGAAATGGATAAAGCGGGTA
CTGTCAGCAAGGGTCCTGAAGGATTGCAGCAAATGAGTAA
AACTGAACCGTCAAAGTGTTTCAAACAACAATCTAAATGC
TCTAAACTAGTCCTTCCTTCTTCTACATCATCATCATCAT
CATGTTCAGACCGGGACAATGAAGGGTTTTGTTTGAGGTT
TCTCCTGCCTCAGGTGTACTGGTTCTCTCAGCACTACTCT
TACCTGCGGCTGGGCCAGGCCTGTCTGTCAGTCCTGCTCC
AGCCCCAGGGGGTCTGCCTTCCACCTCTTCAACCCTCTCT
GTCCACTGAATGCTTCCTGCGTTTGGCTCAAGAGGCAGAC
TGTGCAGAAGGGCTGAAGCAGGACATCTTAAACCTCGTCA
AAACAGCCCTCAGCTAGAGAGCAAATGATAATAGTGGATC
TAGTCTGATGAATGTCATCAGTTGTAGGTGTATTTAATAC
GTACTTTAATGAAATGTTTCCCAACCATGTTCCTGGAGGC
ACACCAACAGTACATATTTTGGATATCTCCCTAATCTGAC
CCACTCATTTCAGGTTTTGGAGTCTCTTCTAATCTTCTGA
TGAGTTGATACAGATGTGTTTGATTAAGAAGATGTTAAAA
ATGTGTACTGTTGGTGTGCCTTTAGGAACAGGGTTGGGAA
ACACTGCTTTAATGCACACAGAAGCGGAATGGGATTTCAC
TGGATTACTTTGGATTGGATGAAATTGAAAACTATTTGAG
TTAGGAGAATTATGTTGAACGATGTTTAAAACGTTCTAAA
TTCTGATATTTTCGTGATCACTTTTATTTTTGTTCTCCCC
AAGACGTGTATGTGTAATGAGTAGAATGACCAACTGTAGA
TATTTTTAGTAATTATTTTTGTTTTTTGGCCAAAAAAGGG
TACATGCATCTACATCCAGATATATATAGTATGTGATTTT
TGTAAGATATATTATGTGAATAAGAATATTTCAAAGGTGA
AGAGCTGTTTATGTTCGCTATATATTTTTCTTTTTGTATA
TGGCACTGTATAATTTGTTAATAGAAATCTGGATTGTCTG
TGTGTTGGAGTGCCATCTCTTTTTTTTCTGTACATATGAG
ATATTTAATCATGGAAATGGCCAAATATCGGTGGGAGGTG
GAGAGGTCGGATGATTCTCAATAAATGAGCTCTGTGTTGA
TGTTGTCTGCATTGTCCTAAAACATTTGACCTATTAATTG
TTAATAAGTTTGAAAATTAATATGAAAAATACAGTCCTAA
CGTTTATTTCATTGTAATTCAAATAGGTTTTGAAAGCAGA
GTATTGCTCAATTGATGTAAAAAGCTTGTTATACAAATGT
AGATGATGAATATGGAAATGATGCACTCATTTATTTTTCT
TTATCACTTTTAAAACTTATTTTAAAGCTATTTAAAGTTG
CTTTGTCTAACCAAGTCTTGTTCCAAATTTGAAGCAGGGT
CGATAGACGATGTCCCTAATGTTGGACTATTTAACAAGGA
TTTACGGCTGGATCGCGTCTCACTATAGTTGTTAAACGTG
ATATTTAATTATTCTTGTCTCTGTCTAATGACTCTTCGGT
CTTTTGAATCTATCAGGTAACATGTCATAGCGTCAATACA
CCTTTTCAATCTTTCGCTTTCACGCTTGTACTTAGTGTTT
TTAGCGAAAAAATGTAGAAACTGTTGGTTGCTGTTGGTTG
TGCACCTTTTTTACCAGCCATGTATGTCGACGCTATTATA
ACAACACAGATCACTCCGCCTATTCATGCCAGAGTCCTGC
AGAAAAAGTGATTGACAGGTGGTAATTTGTGTGTAACTTA
TTTCTGATTTGGTTATGGGTGAAACAAAGACCATGTGGGT
CAGGTAGTTAACTATTTATAAATAATTTATTCACCGCCGC
CTACGATGATGATGCCATTGTCCATTGCGATGTTTCACAT
TACACATTGTAGGATGCCAAATTGGTTGACAACGCCCAAT
CCTAATTTGAAGTTGATATCACAAAAATTCCTGTGATAAA
TGTGCTTTACAAGACACTCACCTGAATTAAATGTATTTAT
TTTGATTATTCTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations