Transcript

twnk-201

ID
ZDB-TSCRIPT-130528-467
Name
twnk-201
Previous Names
  • peo1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058825 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058825|OTTDARG00000040792|ZDB-GENE-030131-5569 peo1|OTTDARP00000045940 peo1-001 LG_ FQ312018.3 Danio rerio protein_coding KNOWN, 2771 bp
GTTTGCACTGGGACATGTAGACACATGATAGCAGTTTGGC
GCGCTTCTTACGGGTTTTGTGTGATGTCCTGAGTGATCGT
CAAATGTGGAGGAGCAGGTTTCTCAGATCTGCAGGCTGTC
TCTTACAGGCAACGGTCTGTAGTCCTCATAAACTCTCTCA
TCTTCCTCAATGGAGATTTTTATCTTCTCACCAGCCCCTT
CTCAATCCAGTCCTGCAGCGCTATTTAAGACCACCATCGT
CTACATGGTATTGTCCTAAAAGCCATATAAACCCCACAGT
TGCCTTATATTTCTGCAGAACATTAAGAAAAGATGCAAAG
TCTGTCATCGATTTCGACCAGCCTCTCACGGTCACTGACA
TCAAACAATACCTTCGTTTTAAAGAAATCCCTTTCCACGA
TGGCCACAGCTGCTTACACGCTCCCAGTATTTTTACGGCA
CCCCTGCCTGAAGGATCGGGACGGGAAAACTTCTCGCTCT
TCATTGATAAAACCACCGGACAGTTTTTATGCAAGGACAC
TTTAGTAGAAGGAAACTGGGAGGACTTCCAGGACTGCCTT
GAGGTGATGCTGAACGAAGGCCAAACCTCCATCAGCCCCA
ATGTTCTCCTAGGGTTTCCGGAGAGCCTGGAGGAGCAGGA
GGAAAGAGGGATGGAGGTGAAGGAGGTGCAAAGAATTTGG
AGCAGCTCCGTGCCTTTTTCCGACCTCATGGAAGACGAGG
TGCAGCTTATTAAAGCCATGTTTCAGATCGCCAAACTCAC
CAATGCTACTCTAAAGAAATTCGGAGTTCGGTTCTTCAAG
CCTACCAAGAGTTTGGTGTTTCCTTGGTTTGGCGGACGGG
ATTCGGGACTTCGTGGTGTTAAATTGCTTTCGGCCTCGAC
GAGGGATGACGGACGTGTGGTTTATACTGAAGCCACAGTG
CCAAAAGTCTCTAGTTACCACAACCTCTTTGGCCTGCCTT
TGGTAGGACGCAAGGACGCCGAGGTTGTGTTGACAGGACG
CGAGGTGGACAGCATGGCGGTGAGTCAGGCTACCGGTCTG
CCATCTTTGGCCCTGCCACGGGGTGTAAGCTGCCTGCCAC
CGATCCTCTTACCGTATCTGGAGCAGTTCAAGAAAGTCAC
ACTGTGGCTGGGTGGAGATATGCGTTCTTGGGAAGCCTCC
AAAATCTTCTCCAGGAAACTCGGGCTGAAACGCTGCTCTC
TTGTCAGGCCTGGAGAGTTTCAACCATGTCCCAGCGAGGC
ATTGGCGCAAGGAAGGAACCTGACACGAATCGTCAAGGCT
TCGATCCCTGCTGCCCACAAGTCCATCGTGTCCTTCAAGC
AGCTCCGAGAGGACGTGTATGGGGAACTGGCTAATGTGGA
GCAGGTGGCTGGAATACAGTGGTCTCGATTCCCTGAGCTT
AATCGAATCCTGAAAGGACATCGCAAAGGGGAGTTGACCG
TCTTTACAGGTCCCACAGGCAGTGGAAAGACCACCTTCAT
TAGTGAGTGTGCTCTGGATTTGTGCATGCAGGGGGTCAAC
ACATTATGGGGCAGCTTTGAAATCAACAATGTGCGCCTGG
CTAAAATTATGCTGACCCAGTTTTCCAAGCAAAGGCTGGA
GGAGAACCTGGACCAATACGACATGTGGGCTGACAAGTTT
GAGGACCTGCCTCTCTACTTCATGACCTTCCATGGACAGC
AGAACATCAAGACTGTTTTGGATACCATGCAGCATGCTGT
TTACGTTTATGACATCAGTCACGTGATCATTGACAACCTG
CAGTTTATGATGGGTCAAGAAAATCTGTCTGTGGACAAGT
TTGCAGTACAAGACCACATCATCGGCATCTTCAGGAAGTT
CGCCACAAACAGCTGCTGTCACGTGACTTTAATTATCCAC
CCTCGGAAAGAAGAGGATGATAAAGAGCTGCAGACAGCAT
CCATCTTTGGCACGGCTAAGGCCAGTCAGGAAGCAGATAA
TGTGCTCATCCTCCAGGAGAAGAAGCTGGTGACGTGTCCA
GGCCGGAGGTCCCTGCAGGTGGCCAAAAACCGATTCGACG
GGGACGTGGGCGTCTTTCCCTTAGAGTTTAATAAAGCCTC
GCTCACCTTCTCTGCTCCTGTGAAGGGAAAGCAGAAGCTT
CGGAAGGTGAAAGTGGATGTTAATGAAAACACAGAGGAAA
CCGAGGAAGCTGAACTGAAGGAAATGAGCGAGAAACCTCT
TAAAGCTGCTAAAACCAAGAGCTCAAAGACTGTCAAGGGG
TCGACAGCAGCAAAAAGCACTGCAGATTGAGAAAAAAAAA
GAAGAGAATTTGTGATTAACATGAAGTCTAATACAGTGTG
TAATATGTGGAACTGAAATGTTGGATTGCTGCAACAAAGC
AAACTTGGAATATAGAGAGAATCTGGGGGAATTTATGTGA
GGTGGTGGTGAATATCTCATGTTGTCTCATTGCATTAAGA
TGTAAAAGACACTCATTGTATGTCAGAAGCTTTAAATCTT
CTTAAAAGGATTTTTTAAATACGTTTCTGATGTTTTATAT
GATCTGAAATGCAACAAAGTAAGTCGTTTTTAAGACTGAT
TTATAGCACTTGTCATCTAATACGAGACCCCAAACTTGCA
TTTGTAGAAGTCTTGTCATACATTTCATGTCATCAATGTA
AATATAGATTATGTGCAAACAAATGTAATGTGAGCTTTTT
CTATGTCATTGCTACTGTAGGAGAAAAGTGTCAAATATAA
ATAAGCTATTTCAAAGTGAATGTGAATATTCCTAATAAAA
GTTTTATAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations