ZFIN ID: ZDB-TSCRIPT-130528-459
Transcript Name: hlfb-201
Previous Name: hlfb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058801 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058801|OTTDARG00000040781|ZDB-GENE-110420-3 hlfb|OTTDARP00000045921 hlfb-001 LG_ CU929285.15 Danio rerio protein_coding KNOWN, 1039 bp
CTTCAAGCCACTTATGCCGGTGCTGTAGAGCAGGATCTCT
CAGTTGTCGTTATTAGTCGAATGATCGCTTTTTACCTGTT
ATAGCTTTTCATTTCAATTCAGCTATTCAAAGAATTATTT
TTACGGAATAAGAGAGATTATGTCCAGACAGCTCACCATG
AATCCAGCTTTTCTACCTCCGCAAACTAACGGCGTTTTGA
AGGCGCTCCTGGAAAAACCTCTGAAACTGCCTTTGCACCA
AGATGAAGGCTATGGAAAGGAGAGAGACAAGGTTAAAAAG
CTGGACGAAGAGGGAAACCCTCCGCAGTCTGCTTTCTTAG
GGCCAACACTTTGGGATAAAACATTGTCTTACGATGGAGA
CAGCTTTCAGTTGGAGTATATGGACCTTGAAGAATTTCTC
TCTGAAAACGGCATCCCCTCCAGTCCTGCACAACATGACC
AAAACCTCCATCAACATCATCACCAGCAGCAGCAGCAGCA
GCAGCACCAACAACAGCAGCAACAGGTTTCAATGCCCCAG
GGGCCTATCTCAGTCATGGACCTCAGTAGTCGCTCCATCC
ACACAGCCATTTCTCCTCAAAACTGCCTCCACAGCCCTGG
CAGATCAGTTTTGCCTCCATCCCGTAACACACCGAGTCCA
GTCGACCCGGAGGCCCTTCATATTCCGGTGAGCTACGAGC
CCGACCCGGCAGATCTCGCTCTCTCCAGCGTCCCTGGACA
GGAGGTTTTCGATCCACGGAAGCGCAAATTCTCCGAAGAA
GAGTTGAAACCTCAGCCTATGATCAAAAAAGCACGCAAAA
TCTTCATTCCTGATGATTTGAAGGATGAAAAATACTGGGC
ACGGCGCAGGAAGAACAACGTGGCTGCCAAGAGATCACGA
GATGCTCGGCGTCTGAAGGAAAATCAGATTGCCATCCGGG
CTGGTTTCCTGGAGAAAGAGAACATGGCCCTCCGTCAGGA
AGTCGCTGACCTACGGAAAGAGCTGGGGCGGTGCAAAAAC
ATCTTAACCAAGTATGAAGCTCAGCACGGGCCCCTGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hlfb-201 Contained in:
[BAC] CH73-390M3 (1)

Genome Resources: Vega_Trans:OTTDART00000058801 (1),  Ensembl_Trans:ENSDART00000153167 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:GU434295 (1) 894 nt
GenBank:EB898391 (1) 286 nt
CITATIONS (2)