ZFIN ID: ZDB-TSCRIPT-130528-439
Transcript Name: gucy2g-201
Previous Names: ch73-92e20.2-001, gucy2g-001, si:ch73-92e20.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058740 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058740|OTTDARG00000040753|ZDB-GENE-130531-70 gucy2g|OTTDARP00000045882 CH73-92E20.2-001 LG_none CU459185.9,CU462848.14 Danio rerio protein_coding KNOWN, 3384 bp
ATGTCAGGAGGATTAGCCTCAGACACAAGTCGACCCATAA
GATGGTGGCTGCTGTTTACAGCTTTTACAAACTCTGTCAT
TTGCAACAAAGACGGCCAGTTCAAGCTAACGGTGGGCCTT
CAGGCTCCTCGGAACATTTCTTACCCTTTCAGTTTGCTCA
GGCTGGGGTCAGCGATGCAAATAGCCATGGACAAGATCAA
CTCAAATCCAGCTCTCAGTGGAAACTTCACCTTTGACTTC
GTCTACATGGACACAGACTGTAACGCCAAAACCTCACTGA
GGGGTTTCATCGAGCAAGTAATGGAGCAAAATGTGTCCGC
GTTATTTGGTCCCCCCTGTCCTGAGGAGGCAGAAGTCACT
GGGCTCATTGCATCCACTTGGAACATTCCCATGTTCGGAT
TTGTTGGTCAGACACCAAAAATGGATAACATTCAGGTGTA
CGACACCTATATAAAAATTGTACCTCCCCTTAAAAGGGTG
GGAGAGATCCTTCTTAAAGCATTGGAATTTTTCGGATGGA
AGCATGTTGGCATGATCGGAGGCGGAGCGGATGCAAATAC
GTGGGACAGTGTGGAGGCCCTTTGGAAGTCTGTGGATCAG
CAACTCCGAAGCAAAGTAACAGTGACGATGGGCATTAAGT
TTGACACCAGTGACCTGGAACAGGCAAAGAGGAACTTGCA
AATCATCTCTAAGGTTGCTAGAGTGGTGGTTGTGCTTGCT
AATGCTGAGGACTCCACAGCTATGATGATAGAAGCTCAGA
AACTGGGCCTGATGAGTGGAGAGTATGTTTTCCTTCTGGT
TCAGCAGTTTGAGGTCAGTGGCAAAGTGGACAACCTGTGG
AAGACTTCTGTGAGCGAAACAAATAGAACAATGCTGAAGG
CTTTTGACATGGTGTTTGTACTAGCTGAGAAGTCCTATGA
TGGATATGACTACTATGACTTCTTCGATCAGGCATATGAT
AAACTGAAAGGAGATCCTTTTTACAGCAACCTGTCATCAG
TAAAAGAAGTAAGCTCATATGCTGCCTATTTACATGATGC
TGTCTTACTTTATGCCATGGGCCTCAAAGAAGCATTTAAA
AGTGGCAAAGACATTCGTCATGGACGAGAAATTGTCCAAA
AACTCAGGGACAGGACAAGCATTAGATTTTATGGAGCTTC
GGGTTTGGTTCACTTTGATGAATATGGAGAGAGGAACCTA
GATTATTCAGTATATGACCTGCAACAAACAGAAACTTTAA
TACAATTTGTCTCTGTTTTGGATTTTGACAGCCATACGAA
AATGATCAAACCCACACTAAGGTTTTCGAATATAGTTTGG
CAAAACGGCAAACCCCCTACAGATAATCCAAGCTGTGGTT
TTGATAATGAACTCTGTGAATGGCTAGACAATGAGATTTC
TCTTCTGGTTCTGCTGGTGGCTTTGCCACTGATTGGAGTG
GCCGCAGTTTCTTTGATTACTTTGTTGACTCTGCAGAAGC
TGCGCTTACAAAGCCGCCTGGATGAATCCAACTGGTGGCT
CATCAACTACAGTGATATAACTATCCTCAGAGAGCCCAAA
GGAACACAAATCCTGTCTGTAAACACAACACCAAGCAAAT
GTGGCAGTGGTGGCTCTCAGTCCATGCTCTCCTCCAACAG
CTGTAACACTAGAGAAGCCATCTACGCTACCGTCGGACTC
TTTCAGGGAAACGAGGTGGGCATAAAGTATTTGAAAAATC
AAATCATCCCTGATATCAAGAAACCTTCGATCATCGCGGA
GTTCAATATGCTGAAAGAAATGAAGCATGAGAACCTGGTA
CAATTTTTCGGTGTATGTATTGATCCACCAAATGTCTGTA
TCGTCATGCAGTATTGCAAGAAAGGGAGCTTGAAGGATGT
TCTTGGAAACCATGAAATTGATCTGGACTGGATGTTTAAA
CTGTCCTTTGCGTATGACATTGTTAATGGCATGGAGTACA
TCCATAAGAGCAGTCTGAAGTCTCATGGAAACCTGAGGCC
CAGCACGTGTTTGGTGGACAGCAGGCTTCAGATCAAACTC
TCCGGCTTTGGCCTGTGGGAGTTCAAATGTGGCACCAAAC
ACAGACTGATTCCGTTGGACAGTCCAAAATATGAAGAGAT
GTACTGGACGGCTCCTGAGTTTTTGAGAGAGATCTTCTAC
CCTTTCAATGGCACCCAGAAGGGAGATGTCTATAGCTTTG
CCATAATCATCCGAGAGCTCATATACAGTACAGAGGTGGG
CCCGTATCATGACGTTCATCTGGAACCAAAAGAAATCATT
AAGCAGTTAAGGACCCCTATGAGTGAGGAGCCTCTTAGAC
CCACCCTGTCTGCTGACATCTGTGACGAACGTCTCATCCC
GTTAATTAAAGCCTGCTGGAGTGAAAACCCAGACCACAGA
CCCCCGTTCGGCAGTATCAGAAGACAACTGAGAGACGCTT
GTCCTGAAAGCCATGCCAACATCCTGGACAACATGGTGAA
CAAGCTGGAGAAATATGCCAATCATCTGGAAGAAGTGGTG
GAGGAGAGAACCAGTCAGCTGACCGTGGAGAAGAGCAGAG
CTGATAAGCTTCTCTCTAGCATGCTGCCCAGGTATATTGC
TGATCAGCTAATGGCTGGAAAATCAGTGGAGCCCAGAAGT
TATGAAATGGTAACCATCTTCTTCTCTGACATTGTGGGTT
TCACCACTATGTGCTCTGTTAGCTCTGCTCTGGAGGTGGT
CACTCTTCTCAATGACCTCTACAGCCTTTTTGATGATATC
ATCAAGCTATATGATGTCTACAAGGTGGAGACTATTGGAG
ATGCCTATATGGTGGCCAGTGGACTTCCTATCAGTAATGG
TACTCTTCATGCTGAGGAGATCTCTACTATGGCATTGCAC
TTCCTCTCTTCCATCAAAAGGTTCAAAATAAGGCACCTGC
CCAATGAGAGACTAGCCCTACGGATTGGGATTAATTCTGG
CCCAGTAGTTGCTGGAGTAGTGGGTAGTACAATGCCTCGC
TACTGTTTATTTGGAGATACAGTCAACACAGCTTCTAGGA
TGGAGAGCAATAGTCTTCCACTGAAAATCCATATCTCTCA
GAGCACTGCTGATATTCTCTTGACAATTGGCACATTTGAA
CTGGAGGAAAGGGGCGATATTGAAATTAAGGGAAAGGGAA
CACAGAAAACGTTCTGGTTGTTGAGCAAACCTGGATTCAC
GTTTCCACCCACTGGCCAGGACAGTAATCCAAGTCCTAAA
TCAGGAACAGATTCTTGTCACATCAAACAGGAGAAAACCA
AAGCAGCAAATGATGGAGATTTTAAAGAGAGAAGAACAAT
ACAGCGGACATCGGCAATGACTAAAATGACAGACATGTAC
ACCCTCACTGTACCTGATGTCTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gucy2g-201 Contained in:
[BAC] CH73-92E20 (1), CH73-167A11 (1)

Genome Resources: Vega_Trans:OTTDART00000058740 (1),  Ensembl_Trans:ENSDART00000031154 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB953685 (1) 503 nt
CITATIONS (2)