Transcript

hsdl1-003

ID
ZDB-TSCRIPT-130528-424
Name
hsdl1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058694 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058694|OTTDARG00000006265|ZDB-GENE-041212-31 hsdl1|no_translation hsdl1-003 LG_ CT955964.5 Danio rerio protein_coding KNOWN, 796 bp
ATGATGTGAGGAGACCGAAGAGGAGAATCTGGTGATATAG
CGCGTGTATTAACAAACATAGTGAAGCTAGTTGGGTGCAA
ACTAAAACGTTGAATTTAAAGAGTACAATTTTTCGAATCA
GCAGGTGCTTCAGAGGCAATAGCAAAAGCATATGCAGAGG
AACTGGCCAGGCATGGCATCTGTGTGATCCTGATTAGCAA
AGACCTCAGCAGTGTGTCGGACACTGCCAGACTAATCTCA
AACAATTACGGCGTGGAGGCCATTTGTATTGAGGCAGACT
TTAATCAAGGCCCCTCGGCCTGCAAACCCATAAAAGATGC
CATCAGTAGTAAAGATATCGGTTTCCTTGTTAACAGTTTT
GACGGGACTCTGGAGATTTCTCAAAACTTCCTAGAACTCT
CTGAATCTGTACTGTGGGGCACTATCAATAGAAATATAGC
AGCTACCACCCTTGTCACCCGCCTGGCACTGCCCGCTATG
ATGGAAAAGGGAAGAGGAGCAGTGGTCAACATTTCCTCAG
GGCACTGCTTTCATCCGATTCCTAGAAAGGCAGCTTTTTC
TGCATCTACGGCCTTTCTCGATAACTTCAGTCGCTCCCTG
CACTATGAATATGGTGATCAAGGAGTCTTTGTGCAGAGTC
TGCTGCCTTTTAGAGTCGCATCTCAAAGACCTGAGGGTTC
TGCTCCTCCTGCTAGCTGGTTGGTGCCAAGCCCACAAGTG
TATGCCAGCCACGCTCTTTCAACTTTAGGCATCTCTCACA
GAACCACAGGATACTGGCCTCACAGTATGCAGGTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations