Transcript

tbkbp1-201

ID
ZDB-TSCRIPT-130528-362
Name
tbkbp1-201
Previous Names
  • tbkbp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058503 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058503|OTTDARG00000040647|ZDB-GENE-100203-1 tbkbp1|OTTDARP00000045729 tbkbp1-001 LG_none CR932059.8,BX248092.16 Danio rerio protein_coding KNOWN, 4324 bp
GCAGGACATGAGGTGTTGTCGGTGATGTTTTCTCTTGAAT
CTTCAGCAGTGGCGCTCAAACTCCTCTCTCTCTCTCTCTC
TCTGATCCCTCACTGAGCGCATCTGAACCAACAACAGCAT
CAGCCTCATCATCCTCCAGCACTTCTCTAGTGTCTGGCCC
TTCACTGAAGACATGACGGCAGACGACGGATCTATAAACC
ACCGTTGAGGATCAGGTGTCATGGAGTCTCTCTTCGGGGG
TCAGCTGGGCTTGTTGGGGGGCAGCGAGGGTCTGAAAGAA
GACGGCTGCGGGGTGGGCTGGTCCAACTCTCCCTTATCAG
ACGACATGTATTCGGCCTCCCAATTCGCCCTCATCAGTGC
CTACCAGGACATCAAGACCCGACTGGCTGGCCTCGAGCGA
GAAAACGCAGACATCAAGCGAAAACTCAAGATTTATGAGA
TAAAGTTCCCCATGATAAGCGAGTTTGGAGAGGACAGAAA
CTCCTACTGCTCCTTCGAGCCCAAAGACACAGCACTACTT
CAGTCAGAGAATGGCAGTCTGCAACAGAGAGTCAACATGC
TGACCCTCGAGCTCCAAAAGAGCAAAGAGCGTGAGGAGCA
GCTTGAAGATGTCATTCAGGCTTATGAGAAGATCCACATG
GAGAAGTCCAGCCTTCAGCGAGACCTGGACAAGATGACGT
CTCTAGTGGAGAAACACGTCGAGCGGATCCACGGTTTAGA
GGCGGCTTTGAGGCAGAGGGAAAGCTCTCTACACAAACTC
AACACACAGCTACACAACAAAGACATGCAGTATCTGCAAC
TGCACAGCCCTGACTCGCATATGCTGGACTGCCCCATGAC
CCTGCAGAGCTCCCGCAGTCTGGACACCCTCTCTGACCTC
AAACTGCAGCGTTTGGAGGCGGAGCTAGAGGGGGCGAGGC
ATGAGGCTCAGGGGGCGTGTCAGAGGGAGGAGGAGATAAA
GGCTGAATGCGAGAGACTGAGGGAGGAGCTGAGGGAACTG
CAGAGCAACCACAGACAGAGGGACGTGAGCTCCACATGTG
GACAGTGTGATGTGGAGTGGATAAAGAAAGTTGGAGATGA
ACAAGTAAATCTTGCTTTGGCTTATACTGAACTAACAGAG
GAGTTGGGCAAGTTGCAGGCTCTGACCTCAAAACAGACTG
AGATACTGCGGAAAGCCTCACAGGAGCCGGCAAGCCCAGT
TCAGCGCCACTCTCCTGTCCCTCACCAGAGGCATTCGCCC
GTTCCACAGCGCCATTCTCCAATCCAACAGCGCCATTCCC
CCATCCAGCAGCGTCACTCCCCTGTGCCCCAGCGGCGCTC
CCCTGTGCTGCAGCGTCTCTCTCCGGACATGCACCGTCGC
TCGCCCCTACCTGAACTCAGTGACGGCCCTGCATCCTATT
CCTGCAGGCCTACTTCCCATCACCTGAGGGCCAGTTTCCA
GGGAAGACGCAGTTACTCTGAAGTAGCTGATCCATCAGCT
TATCAACGTCCTCCACGGTTCACTCTGGACCCGGTGTCCA
CCCTGCCGAAACCTCGACCATACGTTGACAGCTACCACAA
GCAGCAGCAGCAACAGCAGCAGCAACAACAACAGCAACAC
GGAGGAAGCCAGCACATGTTAGTTCAGAGACAGAGCTCTC
AGTCTGGGGTTGGAGGCGATGGGGGATTGGTTGAAACTCC
ACGGCTGTCCAGGGAGTTATCTTTCCACCACTCAGAGGTG
TCCCACTTGCATTTCGATCCTCAACCCAGTCCAGCGCCTC
TGCATTCATCCCCACAGCCTCCGCAGTCTTCAGAGGATGA
GGAGGAGTGGTCCTGCCCTCATCCAATCAGTCCTCCGCGA
ACACTAGGGGTGTCGAGTCCCTCATCGAGCTCCAGAGGTC
CAGCCTCTTGTTCAGCATTCCCTATTCCTTCCCGTCCCAA
CACCCTAAGCTGCCACCCACCAGGATACCTGCATGCAGAG
CACGCCCAGTCTTGGCCATCTATCAATCTGTGGATGGAGA
CGGAGGAGGAGGGTGATGTCAGGAGCTGCCCATTGTGCCA
GCTAATCTTTCCTGTTGGTTACCCTGATGATGCCTTGATC
AAGCACATTGACTCGCACCTGGAGAACAGCAAGATCTGAC
ACCCACAGCCACGTTATGACCTTCTGTTGTTCCACAGTTA
CATTCATTCGCCGCTCCTGGTATTTTTAGCTGGGTGCCTT
CAGACAGAATGTAGGCGATGCACCTGTGGCCAGTCTTTCA
ATTTGATAAGTGAAACGAAGATCAATGACAACCTACGCAA
CTCATATCTCTATGTATTTTGCTTTTTCTTTTTTTTTTTT
TAACAAATGTCTTGCAAGATTGTACCATCTTAAACACCAA
TTATCAGCAATTACACACACTAAATAGACACTCCAAATGA
GCGTATTGCAATATAAAGGCTCATTTTCTACGCTTCTGGC
GACAATTCCCATGATTATTTGCTTTTCGACATATATCGTG
ATACATTTTATGAAAACTGAGATGTTATGAGGATGCTGTA
TGGGATGATTTTGAGGAAATTTTACACACACAGCCAATGG
TTGCATCATCTGAATTTCAGCACTTTATATAAGCACTTAA
TATCCAGTTTACCTTTACCAATACTACTAACACTGAGGCA
AAAAAGTAAAACCTAACAGATATTATTTATTTTTTAATAT
TCCAGGGTGTCACCCTTAAAAAATATATCTTAGTTTGGCA
GGACTTCCCTTTAAAAAAACTGGATTATTTGTAAGTATCT
GTAAATTCACGCTCACATCTATTTTGTTGGTCTTCCGGGG
TGTTTGGATGTACAAAAAGGGGAGTTTCTTTTTTTATTTA
TTATAATTCTAATGTATATAATGATTGCAGCTCTGTGTTT
CAGCCAAACACTGACAAAACACCAGTTACTGTTGTTTCTA
AAGACAGTAATACTGTGATTCCAGGAGTACACTAGGACGA
TGGATGGTTTAATGAAATTTTAATGTAATTACCTAAGAAA
AATTGTAAAACATCACAGGGCGCAATCAGTTTTTTTAACA
TACTGTAAATGTATACATGCATTTAAGGTCAATTATATGT
ATTATTAACCTGTAAATTCAGCTATATAATATAGATATGC
ATTTTGCAAGCAAACAAACTGCTGAATATTAAAAGAAAAC
TATTGGATCTGCTAATAAGTTGTTTTTTTCCATTCGCTGT
AACCCAAACAATAAAGTCACCTTGCTGAGTATTTAATTTG
CTAGCTATCTTATTATTCCATATTCTTCGATGTGTACCCT
ATGCTATAAAGTCTTCTTTGTAGTTACTTTCCCTAATTCA
AAACGGGGCGCTGGATATGCTACTAACCCAAATGCAGAGG
AACTAATTTGGGAAAGTAGCACAAAGAAGTCAGTCATCGC
TGGTGCACATGTGTGAAATTACAAAGCCAAATATAGCAAA
CAGCAATGAGAAGCTGTAAGTGTCTGTCTTATAAATGAGT
GGAGGATTCGTCCAACTGGTCATTTAATATAATGTGAAAA
CTGCTAATATTCTGGAAGAAACCATAACTGATGTTGTAAA
TATGAATTGTCTATTAAATCACCATTGAATATACCATACT
AAAGGCTTAAAAAAAAGTATGGTACGGATATAACTGCAAC
TGAAATACCATCTATACAACCAAAGACACAGACTGCTTGT
TTTCTTTTTACACATGTTCACTTTAAAGCATATTTTGTTG
AAATATGGACCATTTTTAAAGGAAAACCCCTGTGAAATTA
GTGTGCGCAGACATGGAGCTTGCAACTGGAGTGTAAAGAC
GATCAATTACTGCAAAAATCACACAAAAGTTTCCATATAC
AGTATTAACTTGTCTTGCACCCTTGTTCAGAATAAAAGCA
AAGTAAATCTTCAGCCACTATTCACAAAGATTCGCTCAGG
AGTTATTTAAAGAGCTACTGCCGTTTCCTTGCTCCTCAAG
ACAGTGTTTTTCTCATGGCAAATTAGAAACTGAGTGCTTC
TCTGGATGCTCAAAGTACATGGTCGCTCTGTTGCCCTGCA
GTTTGGTGTGTGACTTTTTGTGATATTTTTAAATAACTCA
GGGGATAAAGCTTTGTGAATATGGCTCCTGGACCATACAC
GACTGGCCTCCACAGAAACAACGGGACAAATCGCCAAATA
TTAAAGAGCTAAGAGGACACTAATGGGGTAGAGATATTTT
GTTATAGGAACAATGTACTTTAAAGAAAGCAGAAAAAAGA
TGATAAAAAGACACTAAAGTGAATGCATATTGTGTCAAAA
ACTCTTCTGTAAATATTATGAAATAAACTGGAACATGCAC
TGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations