header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-297
Transcript Name: chadlb-201
Previous Names: chadlb-001, socs7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058302 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058302|OTTDARG00000040561|ZDB-GENE-121205-5 chadlb|OTTDARP00000045585 socs7-001 LG_ CR450737.5 Danio rerio protein_coding KNOWN, 2681 bp
GCAGGTCATCTCTCACTCCATTGCGCTTTGACCATAAATG
CCCCGAGTTCACTCAGCCTTGAGACGAACCTTTCAGGCGA
TTTTTCTCAGTATTTTGATTCTGGAAGAAATACAGGCGTT
GATCCCTATGCGCTGAACCTTTTCTCCTGCAGTAGTTTAT
TTATGAGAGACTGATGGCCGACCTGAGAACAGTGCGCGTC
TTTGTGTGAAGCCGAGCTGCGGTCTCCACTCGCCTGAGGC
TCGACGCGCATATTTCACACTTGGAAAAAATATGATTTTC
GGCTGTTCGTTCGCAGTCCATAAGATGTAAAGTCTTCTAA
CTTCTGTTTTCATTTGACGGATATTACTGAACGAAGACTA
ACCTTCGTGTAAGAAAGGACAAAATGGGTAGCATTCCGAC
CTGGCCAGTTATAATATTGTTTGCCCTGAAGATTCATACA
GCGCTGTCGGCCAAATGCCCAAAAGTCTGCGTTTGTGACA
GCATCCAGCTCACCATTGCTTGTGTCAACAAGAATCTCAC
AGAGGTTCCACCTACCATTGATGAGATAACTGTGAAACTG
GACCTGCGAGGAAATGACCTGCAGGAGCTTCCTACAGGGG
CGTTCGCGCACACACCGTACCTCACACACCTGTCTCTACA
GAATAGCAACATCCGACGAGTGCGGGAAGGAGCCTTTAGA
AAACTTGGCCGGCTGGTTTTACTCAACCTGGCCAACAACA
AGATTGAGATCCTTTACCAGGAGTCATTTGATGGTCTTTC
CTCACTAAAGCAGCTGATTATTGACCGGAACAGAGTGGAG
GAGATCCAGCCTGGAGCTTTTTCACAGCTGGGCTTTCTCA
ACCTCCTGTCCCTCACACACAACCAACTGGTGTACATCCC
TAACATGGCGTTCCAGGGTTTGCAGAACATTAAATGGCTA
CGTCTCAGCCACAATTTCATCAATTATCTGGCAACAGAGG
CATTTGCTGGCCTCTTTACTCTTACCAGGTTGAGCCTGGA
TAACAACGAACTGCAGTTTTTCCCCACTGAGACCATGACG
CGACTTTCAGAAGTAACTCGTTTAGAGCTGAGCTTCAACC
CCATGACGTACCTCGGAGAGGAGTCTGTGTCGATGCTGAA
GCTCACTCACCTCCTCCTGGACCACAACTCCCTGCAGGAC
TTTTCAAATGCAGCTATTCTTCTGTCTCCCCGTCTCACTC
ATCTGGACTTGAGCCACAACCAGCTGCGCATCCTGCAGCC
AATGGCCCCCGGGTCTCCCAAACTGACCCGGCTCAATCTG
GCAGGAAACCCCATCTACTGCAGCTGTTACCTGCGGCCCC
TGCGTGAGTGGGCCACACGGGAGCGTGTTCGTCTGGGTGG
GACATGTGGAGGCCCAGCGCATCTGTCCGGTGAGAATCTG
GAAGTGGTGCAGCCTGTCAATCTGCGCTGTCTGAGTCAAG
AGGCCATGCTGAAGGCTGAGCTGGAGGAGCAGGTGCTGCC
TGCACTGCCCACAACACCATCGCCAAAGAAAGGCAAATGT
CCAGCCAACTGTGCATGTGAGACTGAGAACCGCCATTCAT
CATGCGAAAATAAAGGCCACACCAAGATCCCTCGTGGATT
TTCTCCAGACACACGCCTGCTGGACCTGCGGGGCAACCAT
TTCCACTACATCCCTGCAAACAGTTTTCCAGGAACAGCTG
AAGTAGTTTCCCTTCATCTGCAACGCTGCAAGATTCACGA
TATAGAAGACGGAGCCTTCAGTGGTATGAAGAGTCTGGTC
TACCTCTACCTCTCAGAAAATGACCTTACATCACTAACTC
CCGAGGCATTCAAAGGTCTGCCCCATCTCACCTACCTCCA
TCTGGAGAAGAATCGTTTCACCCAGTTCCCCAAAGGAGCA
TTTAAGCTGTTGCCTGGCCTGCTGGCTCTGCACATGGAGA
ATAATGCCATCGCTAAACTGGAAACAGGGCTCCTGACAAG
CGCTGAGAAATTGAGGGGTCTCTATCTCACTTCCAATGCC
ATCACAGCGGCAGCTCCCCAAGCTTTTAATCCTGCACCCG
ACTTGGAGACTCTTCATTTAGGCAGCAACAAATTGCAGGA
GGTTCCAACTGAGGCCTTTTCCAAAGCCAGAAGCCTAGCA
GAACTCAAGCTCTCCCATAACCCCATTCGCTGGATTGGAG
CTGGAGCCTTTCAGCCAGTTGGCACCACACTTAGACATCT
ATACCTTGATCATATGGGCTTAGAAAAGGTATCTACAGAT
TTTCTAGCAGGACTGGGGTCTGGTCTGAGGAGTCTGCTTC
TTGAAGGGAACCAGCTCGAGGAGCTGCCTGACTTGAGTCC
ACTCACAGGACTCGAGGTCATAAACTTAGCAGAGAATCCA
CTGCTCTGCGACTGTCCACTGTTACCTCTTCGCAAGTGGA
TTGAGCAGGTGAATTTGAAGGTCAGAGCAACCTGTGGTCA
CCCACCAGAACTCAGAGGTCAAAGAGTCAAAGATGTCCAT
GTTTTTAAGAGTTGCCCAGGGGGAAAGTCTCCTTCTGCCC
AGCACCCCAAACCGACAAGAGCCCCAAAGCCTGAATCTGC
TCGCGTCAGTCCTCCAAAAATCATTAAGAGAGTAGACAGA
AAAGCCACAGGAAAATCACGCAAAGGTGCAAAACCTCATA
CAGTGCAGAAAACCGCCATGAAGAAAAGGAAGTCTGCGTG
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chadlb-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058302 (1),  Ensembl_Trans:ENSDART00000153248 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU638790 (1) 2362 bp
GenBank:CR930580 (1) 529 bp
GenBank:EB936759 (1) 432 bp
CITATIONS (2)