Transcript

si:dkey-66i24.8-201

ID
ZDB-TSCRIPT-130528-259
Name
si:dkey-66i24.8-201
Previous Names
  • dkey-66i24.8-001
  • si:dkey-66i24.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049860|OTTDARG00000035077|ZDB-GENE-130531-72 si:dkey-66i24.8|OTTDARP00000039119 DKEY-66I24.8-001 LG_ BX004999.8 Danio rerio protein_coding PUTATIVE, 1595 bp
ACAACGTTACCCAGTACATGACAGCTTAAATCCCTGCATA
CAAACTCATAACCACACGCCACCGTTCAACAGTCATTTAG
ATAAATAGCAGAAAGATCGAATTAAGAGTAAGCTGAATAT
AACGCTGGTAAAATCATGGTCATCCTAGTCGCACCGAACT
GTCCAAACAAACATTAATGACTGGAGGAGATATGCAGCTT
TAAAGATGATGTTTATTAAAGACGAGAGTGAGGATGCGCC
TGATCCAGACAACAGCATAATAAAAATTGAGGAGCACGAA
GACCTGTCAGAAGTGAAAGAGGAAAGTCAACTTCTAGATG
ACGTGCAGGAGGAATATCAGCCTCAGAAAGCTCATGAAAT
CATCACTAATGAATCCCTCAGTGTCTCCCAAACTATAACG
AGTGTTCCTCAAAGCTTCCCTATAACAACAAACGTCAAAA
AGCCTTTCGCTTGCTCTTTATGTGGAAAACGGTGCAACCA
CAGAGGCCATCTTAACGATCACATGCTGACTCACACCGGA
GAAAAACCGTTCGCCTGCCCTCAGTGTGGAAAGAGATTCT
CGCGCAGGCGAAACCTCAACGATCACAAGCTAACCCACAA
CGATGAGAAGCCTTTCGTCTGTCCTCAATGCGGCAAGTGT
TATAAACGCAACGAACACTTTCAGAGTCACCTACTAAGTC
ACAATGCAGGCAAACCCTACACTTGCTCTCAATGCGGAAA
GAGTTTCAGCTATAGAAGGACCCTGAATGATCACATTAAA
ATCCACACGGGCGAGTGTCTTCACGTTTGTTTACAGTGCG
GAAAGAGTTTCCTGAATAAGGGACACCTAAAGGAACACGT
AAAAATCCACACAGGAGAAAGACCTTTCTCCTGCCCTCAG
TGTGGAAAGAGTTTCATGAGCAAACGGGACGTCGCCTATC
ACATGAGGATCCACACAGAGGAGAAGCCTTTCAAATGTCA
CCTGTGTGAAAAGGGTTTCGCCTGGGCAAGCTGCCTGAAA
ATTCACATGAGCCACTCTCACTCTGGCGTGAGGCAGTTTA
CCTGCGAGCACTGTAACAAAAAGTTTGTTCTGGAGTCCTA
CTTGAAGAGGCACCTGAAAATCCATCAAAACGAGAAACCC
TACGTCTGCTCCGTTTGCGGGAAAGGGTTTTTATGGCAGC
TGTCTTTCAAGGCGCACCAAAAAATACATGAGGGGATGAA
GACGCATGTGTGCTCGGAGTGCGAAAGAGCTTTTACCAGA
GCCGACTATTTGATAAAGCACAGAAAAGTGCATACAGGAG
AGCGACCGTTCACATGCTCCTATTGTGGAAAGAGTTTCAG
CAAGAAAGCGAACTTGGGAGAGCACGAGAGACTGCACACT
GGAGAGAAACCCTTCATCTGCGGTCACTGTGGAAGCGGTT
TCACCTCAGCGAAACGCTTGAGCTATCACAGAGAAAAGCA
GTGCGCTGGGATCGCAGTGGATTCATGCTCTGTGGAAGTG
GTGATTGTTCCAGATTTGATTGAGAATTGCATTCCTGTAG
ATTCTGCCACACACAACCTTTAGGGGTGAATAGACTGATA
TTCCGTGTCTGTGGCAGCCTTGACTGAACAGGTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations