Transcript

zdhhc6-201

ID
ZDB-TSCRIPT-130528-185
Name
zdhhc6-201
Previous Names
  • zdhhc6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000058739 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058739|OTTDARG00000040752|ZDB-GENE-030131-3189 zdhhc6|OTTDARP00000045881 zdhhc6-001 LG_ CU459185.9 Danio rerio protein_coding KNOWN, 2255 bp
ACGATTTCTTCCTGTCAATGGTTCCGCTGTGGGGTGAGTC
GTGCGATTAATTGTTTGGTCTTCCTCGTTGAATTGCGTGT
AGTTATTTTTGAAAACGGATTTAAGCTTTGACAGTATTAC
GATTGGCTAAATAGCGCGTTCACTGGGTCATATTAAGCGG
CGCTGTCATTTTTCTTGGACTCTGACCGCACGAGGAAACA
GTAGTCGAGATGGATGGTCTGGCTTTAGCTCGAGGATAGT
GTGATCAGAGGATTAGTAGGAAAGGATGCCACACAGAGTC
TGCAGCTCTAGGAAGTGGCTGGCCCCTGTGACTGGTGACA
TAGCCGATCGCTGGTTGTTTCGGAGAAGACAGAAAAGATG
CCCTTTGACCTCTTTAAGTCACTGCAATAAACGGAGACAG
CAGGCCTGACTACTTCATAGCTGTAACACTGAGGACCTTA
AAGACACTGACATACATCGTAACAATGAATATACTGTCTG
CTATAATCGTGTTTGAGAACCTCCATGAGGTCAAGAGGCT
TTTTCACTGGGGTCCGATCATCGCTCTGACAGTCATCGGC
GTTTGTTCCTCCATGGCCATTCTGGACTCCATTATCTGGT
ACTGGCCACTGGACACCACTGGAGGAAGCATCAACTTCAT
CATGCTCATTAACTGGACCGTCCTCATTCTTTACAACTAC
TTTAATGCCATGTTTGTGGGCCCTGGTTACATTCCCCTAG
AGTGGAAACCGGAGAAACAACAAGATATAATGTACTTACA
GTTCTGTAGATTGTGCCAAGGCTATAAAGCACCAAGGTCA
CATCACTGTCGCAAGTGTAACAGGTGTGTGATGAAGATGG
ATCATCATTGTCCCTGGATCAACAATTGTTGTGGTCACTT
GAATCATGCATACTTCACCAGCTTCCTCCTGCTTGCTCCA
CTGGGCTGCATTCACGCTGCACTGATATTTATCATGACCA
TGTACACTCAACTTTATGACCGGATCTCATTTGGTTGGAG
CTCGGTAAAGATTGACATGAGTGCGGCTCGGCACATCCAC
CATCCCATCATGCCTTTCAGCATTGCAGCATTTGCAGCCA
CGCTTTTTGCACTTGGACTCGCACTGGGTACTACTATTGC
TGTGGGGATGCTGTTTTTTATTCAGATGAAGGTGATTCTT
CGAAACAGAACCTCAATAGAAGCATGGATTGAGGAGAAAG
CCAAAGATAGAATCCAATACTACCAAACAGGAGAAGACTT
CATCTTCCCTTATGACCTGGGCAGCCGATGGGAAAACTTT
AAGCAGGTGTTCACTTGGTCTGGTGCTCCAATGGGAGATG
GAATTGAATGGCCTGTGCATGAAAAGTGTGACCAGTACAC
TTTAACTATAGAGCAGCTGAAGCAAAAACATGACAAGCGT
CAGAGGAGTGTGGAGTACAGAGTGGTGGAGGAATATAATG
GAGCCTGTTGTCCATTGGGAAAAGGACTTAACACTTTCTT
TAGGACACCTTGTACGGAGGAGCCCAGGATCAAACTGACG
AAGGGGGAGACCATCTTTGCTACTAGAGGAACAAAGTGGT
GGATGTACGGAGACAAAGTTTTGAATGAGGAGCAGGCTAA
AGCTGGAGTTCGTATCAGAGGATGGTTTCCTCGCCGATGT
GTGGAGAAATGTCTCTATGACTCAGCCAATAACTCGACGA
GTGAAGAAAAGAAAGAACAATGATGCAGAATTTCACATCT
AAACAGAAGACCTGAAATATGGGCCTGAAACCCTGCTGAC
ATGCACATTTCTTTCTGATTCTTTTTGTAAAGCTGTTCAA
TGGCACCAGCGATAAGTGTTGAATTAAACTGATACTGACA
CCCCAAAGGTACTAACCTCTGAAACTTAAAAAGAACAAAA
AAAAATTTGTAAAAATCATTTCCAAAGAAAAGCTGGCGGA
AAAAAACTGGCTAATGAGAAGGAAATGAGAGTTTTATAAT
AATGGGATCGGGATGTATGGACGCTTATTCTTTAAAGGGG
ATTAAGATTTTACTTGAAAATTGTAGTTTCTTCTTGCCTT
TCTCTTACTCGCTTGCTATTTCTGGTTTGTTGATGCTCAC
ACTGATTATGCAAAGCCTTTTCCAGTCTTAACCAGGTGTT
TGTCATGCAGATTTCTCTTAAATTGTTTATATAACTGAAT
AATTTTATTTTATTTTTGATGTCTTTTTTGTAAAACTGAT
GTCAACCTCGCTGAAGTTTTCAGAGATGAATAAACAACCT
TGATCTGTACAGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations