Transcript

taar14i-201

ID
ZDB-TSCRIPT-130528-182
Name
taar14i-201
Previous Names
  • taar14i-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058730 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058730|OTTDARG00000040743|ZDB-GENE-060414-25 taar14i|OTTDARP00000045877 taar14i-001 LG_ CR391946.4 Danio rerio protein_coding KNOWN, 960 bp
ATGTGCGAGGACTACTCGTGTCCAGAGAGATCTGTTTCTT
TATCTGTCTATGTGATTCTGTATGTGGCCGCAGCAGCTGT
GGCTCTTCTGACCGTGTGTGGAAACCTGCTGGTCATCATC
TCTGTTAGTCACTTCAAGCAGCTCCACACACCTGCCAACA
TCCTCATCCTCTCTTTGGCTGCGTCTGATCTGCTGGTGGG
AGTTTTTGTGATGCCATTTCAATTGACTTTGCTGATTGAA
TCATGCTGGATCGCTGGACCGGTCATGTGTGCAGTTTTAA
AATTTGTCAATTTTCAGGCAACAAGTGTTTCTGTTCACAC
TGTGGCTTTAATAGCTGTCGATCGCTTTTTAGCTTTGAGT
TTTCCCTTTTTTTACTCTGAGAAAATCTCCCCCACTGTGA
TCTGTATAGCAGCTTTGCTAAACTGGCTGTTTTCTCTCTT
CTATAACTTTCGTCTTCTGTATGTTAATGGAAACTTCACT
GATATTGTGTGTCCAGGAGTGTGTGTTTATGTCGTAGATG
AGATTTCATCCTTTGTTGATCTCCTGATTGTGTTTGTAAT
GCCATGTACGCTCATTATAATATTATACACTCATGTTTTT
GTCATTGCTAAGAAACATGCGACTGCTATAAGAGCCGTTC
AGGTTCACAACAGCACAGAATCCTCTAAGAACAAAATCAG
CGACAAATCAGAGAGAAAAGCTGCGATGCTGCTGGGGATT
CTGGTCTTTGTGTTTCTCCTCTGTTTGCTGCCATATTATA
CTTTTTTAGTGATTTCATACAGTATTGTTGATTTCATATT
TTTCAGAGATGTTGGTGTGATCATTTTCTTCCTGAACTCC
ACCATTAATCCAATAATTTATGCCTTATTCTACCCCTGGT
TTAAGAAAAGCTTAAGAATAATTTTCACATTTAAAGTGTT
TCAGAGAGACTCTTCCCTGATGAATGTGCAAAGTTATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations