ZFIN ID: ZDB-TSCRIPT-130528-168
Transcript Name: si:ch211-199i15.5-201
Previous Names: ch211-199i15.5-001, si:ch211-199i15.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058687 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058687|OTTDARG00000040727|ZDB-GENE-130603-58 si:ch211-199i15.5|OTTDARP00000047597 CH211-199I15.5-001 LG_ AL845421.9 Danio rerio protein_coding KNOWN, 6120 bp
AGTCAAGAAGAAGTCTACCTCAATGCTTAAAGCCAAGCAA
GCCATTAAAGAAAAAGTTGCAGAAAAACCTGAACCTGCTG
AGAAGAAAACATCTGAAGAAACCAAAGAGAAACCAGCAGC
CGAAGCACCGGCAGCAACCAAAGAGTTGAATGTGGAAGAG
AATGTGACGGAGGGCAAAAAGCCAGGCAAGATACCATACT
TCCAGTGTGTTTTAATGAGTTCGAAATCCGGTCAGTATCC
ACTGCGACCCATGTCCCCTGCTATGAGTCCAGCTATTAAC
CCCACCATGATGAGAGCCATGATGGAGCAGCGGGCAGCAT
TACTGCAGCAGAAAGCCAGAACAGGCGGTCAGTAGCTGGA
CGACAGACCTATCCAGCCCAGGCATTAAAAACTGCTTATG
AACTGCTGTTGAGACAGAGCTGCTGCTGTTGTGCTCTCAA
GAGCAATCCACTTAGACCATTACAGATACTTTAAAAATTA
TGGTTTTCCAGTCCTCCATCATGTGGCATTTGAATTAGGT
CATTTTTTTTTTTAATTTTGCTAAAAATTAACATCAAAAC
TAAATAATCAATGTACATTTGGGAATATAATTAACACATA
AAAGCCTGTCAAAAAACGTGTTAGTGGTTAGATTTGTTTT
TTATTACTATTATTATTATTGTTATTATTATTAATAATCA
AGATCTTAAATCATCTGTTTACATTTGTTGCAGGGAATAT
GATGTATGTTTTTTACTCAGCGCCAGAGCAAATTTAGAAC
TGCTTAAATATTTAAGCATTGCTCTAATTACTCGAGATAT
TTATTTTTCTATGTCAGAGTATATGATCCCATTACGGAAA
GAAATCTAGCAGCGCACATTCACTAAGGGCCCTTATCTTT
CGGTCCAGGCCATTTCCTGCTAATAAGATTATGTGTAGTG
TGTCTGGGTTCTACCAGGGTCTGCAATCTTTCTGCATTTG
TATGCATGGCCATTAGAAAACAGGAGGACGCCATTTGGAC
CGAATCCGATTCCTATCTTAGCCTATGAGAAGAGCTTACA
TCCTCATAGAACTGAAAGAGACATTAAGAAATGAAGGCAC
ACGAAAGCCAACAGTCACTAAATAATAAAAGGCTTTCTCT
GTATACTTGACTGAGACTTCTCGAGTATATGTCTTGAGTT
AATTGAAACTCTTTACTGGGAGCTATTAGATTTACTGAAG
TGAATTTAATAGTGTATGTCTTTGTTGAAGATTTATGCAC
AGGTTAAGCCAAAAGCAATTTTGCTACTTGTGTACAGTTA
ATGCATACAGTGTTTTACAGTATTTATTATATTATTCTAG
ATCAGTGGTCTTCATCATTTTTTAAACTGCAAGAATCTCT
TTGTGAATTGGCCGAAAGTCTAATGTGTATGGCACAATAC
AGTATTGGCATACGTTGTTTTGTTTATCAAGTGAAACAGC
CGTTATTATTAATAATATTTAAAATTAAAAAATGAAATAA
ATTAAATTTATTTTGATAAATGGTGAAACTTTCAGAATTT
CTGTGGCCCACAATACTAGCAAACATATAATCAGACAAAA
TAACATTAAGGCTACGATATAGTCAACCCCACACCCTCTT
TTTTATGTGTTTTGGGTTGGTTTATTTACTCAGTTTTACT
TTAATAATTGTGTTTTTGTTTTTTTTTTGTATTGTACTGC
TTTTATGTTAATGCTCTGTATTTGATATTCATCTGCATTA
TTTACAAATAAGAAAAATCTATAAAAGGTTTAAATATTAA
AATGCAATAGATATTTAGAATTAATTAAAATATAAACAAT
GATTATTATCAATATAAATAAGTCATGCTCCATGTTCTTG
TAGCTTACTTTAAATTAGGCATGGGATGATAACCGGTTTC
AAGGTTTACCGTGGTTTGGAAAAGTCAAGTTTTAAAACCG
CCAGAATTCTGGTATATCGTTTCTTACAGCATATGTACAG
TTTTTTTTTATGTGTTTTTTGCAACTATTTTATTTAGTTT
TTTTAGAACAACAATATCTCCAGCAGTAAAGGACCTTCTA
CATCAAGTGCTACTAGTCTAAAATATTTGAAATGTTTCTT
AAAATAAAATATATTGTTTTTAATGTGGTAAAAAAAAATT
GTTGTTTTCTACACAGACACTTAAAAAAAACTGAAAGAAA
GAAATGCACAATACTGTGCAACCCTGAAACAGTGATATTT
TTATCCAAGGTTATCACACCGTCACAATCTTATACCAGCC
CATGCCTACTTTAAATATATAAAATTTTTTATATGTTGAT
AAGACAATTAATTAAGCATTATAATAATTATATACAATTA
TAATTAATAATCATTATGCTAGACGGTGCTTACAGAATTT
GCCAACTAGGATTTTTGAAGGTAAAAAATTATGAAAAGAT
ATGAAATCCATTGCAAAAATAAAAAGGCATGTAAAAATAT
GCTGAATCCAAACTGCAGATCTAAAAATCAGCACCATGAT
TTTATAATTTTCTTTCAATCTTACATTTGACTTTAATCAC
GATCGCAAAAAAACAGTTTGCTTCATGAAACATTTTTTGT
CCACCTATTTTAAATTAGTCCGACATTTTGCTTTATTTTG
GTAGCCTCTTTGCCTTAAGCTGTGTAAACATCATCAAATT
CAAATAAATTCTTGAGATCAGCCATTACATTTTGAGTACT
AAAATGTGGTTACCAGCTGATAATTTAAGGGATAACTAAC
TAAAAAGCAGTCCTATTAAAGACCCTTTTTCTAGATAACA
CTGTACTGTAAAACACAGTAGCAGAATAATGACAATGTTT
GTGTTGATGACATTACTTTGACCAACAGTGATTTTTTGAA
TATGGTGATCCGAGGTCACGATATATTCTTGAAGGCTTCT
TTTCCTTGTTATTTTTGCTCTGAACAGTGCAATTATTGCA
ATTATGACAATTTATTAGCCAGAAATACTGTGTCTTATCC
AAGAGCACAATGGCGTATTATTCTTTATTTTCAGAAACTT
AAGGATTGGTATGACCTAAAATATATTTAAGGTTTTCAAA
AGTATCAGCTTTGATACCAATCAGTACTGAAATGTTAAAA
TTGTGACAATACTAGAATTTACCGCTTTTATTTTGACCTC
TGCAGAGTTCTTGAACACTGTTGATTGGCCATTGAATTAA
CGTGCTTAGACCTGACTGTGTCAACCATCAGTTTATCTAT
CAGTAGCAGTGTGTGAATTTTACACAGACTTTTTTTTTTT
CAGTAGTACGCATGCGCCCGTGAACCAAATTAAATTATTT
TATTCAATTATCTCATTGGTCAATCAAAAGTTTTCAGTAT
TTTGAAAAAAAAAATAAAAAATTGGATTCTGACCTATAGT
GATCTGGGTTATTTCAACAGTACATGGGTTATTTCAACTG
ATGGGTTATTCTCAAAGATGAACTGTGTTTAAAATGCAGA
ATTTAGCTGAACGATGAAAAGTTTGCATTTCTTCACAAAA
AAAATGGAAGATCATAAAAGACCATCCTATGCATTTTACT
GTTTATCTTCCTTGTGCAAGCATAGGCATCTTTTAAATAC
ACACTACACTGTTAAAAATGCTGGGTTTCATACAATCAAT
TTGTGTTGGAAATAAGTTAACTTAGTTTTTACACATTTAA
GTAGATTGAACATAAAAGAATTAGGTTGTCCCCAAAAAAA
CTCAAGAATTATGTTGTCTCATCTCTTTTTTTTTTATTAT
TAAATAATTTTTCACCTTTATTGGTCAGGACGAGTATTGA
CAGGAAAGCAGGAGAAGCAGAGAGAGGGAAAGGATCGGCA
TAGAACCGCAAAGCAACTCGGGTCGCCATGAGCATATTGA
CGCACTAACTACTACACCACTGGCGCCGACCAACTCATTT
TAAATAAATAGTTTGAACACACATCAAATATATATATATT
TTTTTTAATTAAGTGTTTGCGTCCAATTGTACTTTTACGA
TGTAGATACAAACACCTATTTTGCATGAAAAGTGTGTTTT
GAACACTTACTGTGCAGTAAAATGAACTGAAGCAACACAA
TTCAGGAGTTTTTTTCGGGAGGAAGGCGGAGGATTTAATT
GTTTCATGTTCAATCCACTTAAATTTGTAAAAATTACTAG
GTTTAACTAATCGATATATGTTGGGACACAAGGAATTATG
TGAAAGCCAGCATTGTTTACAGCGTATGTTAATAAGTTAC
TACTGCTTCAGAAGGTTCCAGAGAATGAAGTCCAATAAAC
TTTGGTTCCGACCGCATTAGTTTCTAAGCAAAACGAAAGC
AGAGATTGATTACTGCTGTGCCGGTTAGCAGTTTGTAATT
TAAGATGTGCACAAGTTTACAATACTTGAAGATCAAGGCT
ATTAACCTTCTTCTATAAACATCATGTTGAAATTAGACTG
GCGCTTAAACATCTAGATCTGCCAGTGTTCAGACTTTCAG
ATTTCCGGTAAAGCCTGCTGGACATGATGACATATTTATA
TTACTTGTTATATGTATTAATACTATTAATATTTAAAATA
TTGATCAGCAACTATCTCCCACTCTTTAAAGAGCAGACCC
AGGTCTTGTTTTGACATGTTTCAGGGGAATCAAACCCTTG
TAATTTGCAACCTGGTCAATGGTTTTCTCCCACATCTGCT
CGTGTGCAGATCCTACAGTATGATAAACACGGCTTTTAAC
TGGAGCCAATCAAAGTCATATCTGTTAAGCATGTGAACTC
AATGGCCAATCAACAGTGTTTAGAAACCTGCTTAACAGCA
CTCAAAAGGAAGAAATGGATGTTTTTATATTCCACTGAAG
TGGAATAATATCTAAATGACAAGACCGATAGTGAGCAGCC
GGTGGTATTTCTAAATGCCCCTATGCACACGAGCTACTGT
ACATATGGTCATGGAAAGACTGCATAGTGTTGATACAGTA
TGTAGTGATTGCAGCAGAAGGCTGTTTCTCTTTAATCAGG
ACATAGTGAGACAGATAGCTGTATCTGTGTGACTTTGAAC
AGAAAAGTAGGACACAAAATCATCCCACTTTGAAGATACA
GCATGTAGAGAGGATGTCAACTTTACTTTGGATATCCCTG
TGGATATATTTACTGTGGATATATGTGTAGACTATGACTA
TAATGACAATGATTGATGACATTATATAAAATATTATATA
ATGACATTGTATGAAACATGCATAAAATTCGTTTTTGTCT
GAAACTGAGAAAAATCACTGTCTTACCATAAATGAGAGAC
AGTTTACAGTGAAAATGCCATTGAGGTCAAGTTGGTTTTA
TATTCGCACAGACTTTTCTTAATATTATATTTTCAGAAAA
GTATTATTTGCAAAATCATAATAGGGAAATTATACTTGCT
GCCAAAGACTATCAAAGTTCAACATTCTTCAGTGAATTAA
ATAGTGCTAATGCTGTTTCGAAGTCATACTTGCATGCTAT
TTCTGACCGAATTCTCAAAGTAACATGGTAAGCAATACAG
GGACCGTGTCACAAGATGTCACTGAACGAATATGTGAACA
TAAAACCAACTTTGCCTCAATAAAAATGCCATGTTTACTA
AGTAGAACCTCATCTGTTGATTATCAGAAGGCTTTGAACA
TCATAGATGTACAAAATTCACTTGTAGATCTAAAAGTAAA
TTTTAAGAGGTGACAGAAGACGCTCTAACAGTTTTTGAAT
GTATTTTGTATTTGCATGAGCCTTAAGAAAACCCATGTGA
AAGTCAGTCTCTGATATGTTTTCAAAAGATGCTGCTATAT
CATATTTTTCATGAGACTTACAGTATTGATGTGATGTTGC
ACAGCTGGGATTTGTCAGTTATTAAGGCACATTGAATGTT
TAGTTGATAACAGGATAGAATTTGTGGTTTGATTTATCAG
GTTTTTTTTGTAGGGCACGACATACTGAGCTGTAATTTTT
CATCACCTCGTAAAGATCTAATTAATTCAAAGTTTTAAAT
ATGTTAAACTGTCATGTTTCACATGAATGTTGAATAAGAG
CTGTCAGTACAACTAAAGAAATGTTTCAATGGTTAATCAC
TGTTGTTTTTCTTTCATGCACATCTTGTTGGATTTTATCT
TGGAGTGGGCAGAATTCTGGAAATAAAGTAATTGCTTTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-199i15.5-201 Contained in:
OTHER si:ch211-199i15.5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058687 (1)
  • Ensembl_Trans:ENSDART00000168928 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR926594 (1) 539bp
    GenBank:CT700032 (1) 428bp
    CITATIONS (2)