Transcript

metrnlb-201

ID
ZDB-TSCRIPT-121213-95
Name
metrnlb-201
Previous Names
  • dkey-27j5.3-001
  • si:dkey-27j5.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052813 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052813|OTTDARG00000037069|ZDB-GENE-121214-223 si:dkey-27j5.3|OTTDARP00000041517 DKEY-27J5.3-001 LG_ BX908759.27 Danio rerio protein_coding NOVEL, 1123 bp
CACGCGGTAATGAGCGGTTCATTCTGGACTGAAACACTCA
TTTCTGCTCGCGGTTCGGTCATGTAGGTGTTGAAGATTGC
AGAACTGGGCATTTCTACAGGCTGGAGGAGCTTGACGGGG
GTTTGGAGGATGCTTTTATTGCTTGTGTTGTCAGCTGTGG
TCCTGTGTGGATGTGCACAGTATTCCAGTGATCAGTGCAG
CTGGACGGGAAGCGGTCTGACGCACGAGTCTCACGCGCGG
GATGTGGAGCAGGTGTATCTGCGCTGTGCTGAAGGCTCTC
TGCAGTGGCTGTATCCCACCGGAGCGGTGATGGTGAACCT
GCGGCCGAACCTGCCGTCCTCCGCTGATCTACGTGTGTGT
GTGAAGCCGAGGCGGGACTCTCGCGGGGCCACTGTGCTGC
TGGAGCGGGCGGGAGCGCTGCGGGTGCTGCTGAGCGAGGA
GGAGCAGGCGGCGGGACGCGTGCGCTGCTTCAGTCTGCAG
GAGGGGGCGCTGTTTCTGGAGGCGTCCGTACAGCGGGACA
TCAGCAGGAGGATCACTGCCTTCCAGTATCAGCTCAGCTA
CGCACACACTGCTGATCAACACACAGATGAAGAGCTGCTG
TTGTCCGTGTGCACCAGTGACTTTGTGGCGCGTGGCAGAA
TCAGTCGCGTAGAGGATAATGATGAAGATGAAGATGAAGA
TGGGGTGTCAGTGGTGCTGTCTGTGAGCCGTGTGTATCGG
CAGAAGAGCCGTATATTCGTGTCGGCCGGCGGGGGGCGCG
GGCGTGACCGGTGGACGGGTCGAGTGCAGATTCTGCAGCG
CTGTGATCCGCAGGCCGGACCCACAGAGTTCCTGTTCACC
GGAGCGCTGCGGTTCGGAGACGCCTGGCTGGGATGCGCTC
CGCTCTACACAGACTTTCTCAGAGTTTATCAAGCGGCTCG
GGACGCAGGAACAAACCCCTGCACCATAAACACTGACTAA
ACACACACACACACCTGAAGATCTCTGCAGAACAGGCCTG
ACCGGGACTCTTTCACTGGGAATCAAGAGAGATGAGTTGA
AGTTGTGTTTGGGGGAAACTGGTTTAGAGAACTAAAGCTG
ATTAATATATACATGTTGATTTTCTGGACTTTATATTCCC
TCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations