Transcript

ctslb-203

ID
ZDB-TSCRIPT-121213-894
Name
ctslb-203
Previous Names
  • dkey-239j18.4-001
  • ottdart00000058084
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058084 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058084|OTTDARG00000040457|ZDB-GENE-980526-285 ctslb|OTTDARP00000045481 DKEY-239J18.4-001 LG_ BX465840.13 Danio rerio protein_coding NOVEL, 1289 bp
AAACAAAACTTGGTTTGCTTGTGAAAGTCCTCCAGGCAGT
ATGATGTTTGCTTTGCTCGTCACGCTGTGCATAAGTGCAG
TGTTTGCTGCTTCATCTATAGACATCCAGTTAGACGACCA
CTGGAACTCCTGGAAGAGCCAGCATGGAAAAAGCTATCAT
GAGGACGTAGAGGTCGGGAGGAGAATGATTTGGGAGGAGA
ACTTGAGAAAAATTGAGCAACACAACTTTGAGTATTCCTA
TGGAAATCACACCTTTAAAATGGGAATGAATCAATTTGGT
GACATGACAAATGAGGAGTTCAGACAGGCAATGAATGGTT
ATAAGCATGACCCCAACCGGACGTCACAGGGCCCGTTGTT
CATGGAACCCAGCTTTTTTGCAGCCCCACAACAGGTTGAC
TGGAGACAGAGGGGCTTTGTTACTCCTGTCAAAGACCAGA
AACAATGTGGATCTTGCTGGTCTTTCAGTTCAACGGGTGC
CTTGGAAGGTCAGCTCTTCCGTAAAACTGGAAAGCTGATT
TCTATGAGTGAGCAAAACTTGGTGGACTGTTCCAGACCAC
AGGGCAATCAAGGGTGTAATGGAGGCCTCATGGACCAGGC
CTTTCAGTATGTTAAAGAAAACAAGGGGCTGGATTCTGAG
CAGTCATACCCTTATCTTGCAAGGGATGATCTGCCATGCC
GGTATGACCCCCGTTTTAATGTCGCTAAAATCACCGGATT
CGTGGACATCCCCAGAGGTAATGAGCTTGCCCTAATGAAT
GCTGTTGCTGCTGTGGGTCCTGTATCTGTTGCTATTGACG
CATCACATCAATCCCTACAGTTCTATCAGTCTGGCATCTA
TTATGAGAGAGCATGTAGCAGTAGTCGACTTGATCATGCA
GTCTTGGTGGTTGGCTATGGTTATCAGGGTGCTGATGTTG
CTGGGAATAGATACTGGATTGTGAAGAACAGCTGGTCTGA
CAAATGGGGTGACAAAGGCTACATCTACATGGCAAAAGAC
AAAAACAATCACTGTGGCGTTGCAACATCGGCCAGCTATC
CCCTAATGTAAGGCCACTGGAGCCTTCTCTGCATTCTGAA
AAAGACACGTTTATGGTTTCTCTATTTTAATGTGTTTTTA
TTTCTTCAATTTTATCAAATTGTTCTGCTGTTAGTGCTAT
GATAGTAGTATTTTAGGAAATTCCATTTTTCTTGTGTTTC
ATATATTCTTGTTTATGCAAGAATGAGAATTCTGTACTGG
ATCTATTTGACCTGCAAATGGAAAAATATAAAATTTTCTG
GCATGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations