header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-877
Transcript Name: ddhd1b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058033|OTTDARG00000004047|ZDB-GENE-040724-18 ddhd1b|no_translation ddhd1b-003 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 745 bp
CGGAGGCAGTCGGCGGCGGTGGCAGCTCAGCCGGTACCCG
ACAGCGCGGATGCGGGATGCTCAGCGGACGATTCGGTGTT
CAGGTCAGACAGCGTCAACGTGGACGCAGTGTGTGTGCGT
GGAGGACTCTATGAGGTGGACATCAAAGGAAAGAGCTGCT
ATCCTGTGTACTGGAACCAACAGGACCACATCCCAGTCAT
GAGAGGCCAGTGGTTCACAGACGGCACCTGGTTGCCCTTG
GAGGAGGAGGACAGTGACCTTATTGAACTGGAGCACTTAG
CCTGTTTCCGGGGCCAGCAGATGAAGGACACCTTTGACAC
GGAAGCAGTGGCCACCACAGTGGACAGCAAAGACGCCATT
CACAGTCTGAAACTGAGCCGGAGCCACGTGGACTGGCACA
GTGTGGATGAAGTGTACCTTTACAGCGACGCCACCACCTC
TAAGATTGCACGGACGGTCACTCAGAAGCTGGGATTCTCA
AAAGGTTTGTTAAACATTTGATTAGTAAATACTCTCACGT
GTTGCTAATTAATAGAACACATCAAATCTAAAATAATGCA
AATCACATATTTAATATACAAGTTCATGTTTGGATTTTAC
ACATATAAAACTTGTTATTTCAAAAGATTACAAAAATTGA
ATTTCTTTTCTTTAAAGAGCCCCTATAATGGGTTTTTGAA
ATTGACCTTCCATGTAGTGTGTAACATAGCGCTAAGTGAA
GTGAAATATCCAGCTAAGGCTTAAA

ddhd1b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ddhd1b-003 745
mRNA ddhd1b-201 (1) 3421
ddhd1b-203 (1) 557
ncRNA ottdart00000058035 (1) 510
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddhd1b-003 Contained in:
OTHER ddhd1b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058033 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT724843 (1) 786bp
    CITATIONS (1)