Transcript

drd6b-201

ID
ZDB-TSCRIPT-121213-802
Name
drd6b-201
Previous Names
  • drd6b-001
  • ch211-124e16.3-001
  • si:ch211-124e16.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057474 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057474|OTTDARG00000040072|ZDB-GENE-121214-145 drd6b|OTTDARP00000045048 CH211-124E16.3-001 LG_ CU459092.9 Danio rerio protein_coding NOVEL, 1281 bp
ATGGAGAGCGATGGTGCTGAAAGGAACAGCTCCGGCGTGG
GTGTGCGCGCGCTCACCGGCTGCGCTCTCTGCGCGCTCAT
CCTCTCCACACTGCTGGGCAACACGCTCGTGTGCGCCGCC
GTCATCAAATTCAGACATCTCCGATCCAAAGTCACCAATT
TTTTCGTCATATCCCTAGCAGTATCTGATCTGTTCGTGGC
TGTCCTGGTCATGCCGTGGAAGGCTGTCTCCGAGGTGGCC
GGCTGCTGGCTCTTCGGCGGCTTCTGTGACACTTGGATAG
CTTTTGACATCATGTGTTCAACGGCGTCAATCCTCAACCT
GTGCATCATCAGTTTGGACAGATACTGGGCCATCTCAAGC
CCCTTTCGCTACGAGCGTAAAATGACCCAGAGGATGGCCT
TTATAATGATCGGCATGGCGTGGACACTTTCCGTCCTGAT
CTCTTTCATTCCGGTCAAACTTAACTGGCACAGAGCTGTG
GATCACAACCTCACCGTCCCATCCGAGGACTGCACCGCCT
CTTTAAACAGGACGTATGCCATCGCGTCCTCGCTCATAAG
CTTTTACATCCCTGTTATAATCATGATAGGAACATATACG
CGGATCTACCGGATCGCGCAAACGCAGATTAGGAGGATCT
CCATTTTGGAGCGCGCGGCCGGACACGCGCAGAGCCAGCA
GGACTGCGCGAGCGAGCAGTCGCTGAAGAGCACGTTTAAG
AAAGAAACGAAGGTGTTGAAAACGCTTTCCATCATCATGG
GTGTGTTTGTGTTTTGCTGGCTGCCCTTTTTCGTCCTCAA
CTGCATCGTGCCGTTCTGCGACACTCTTGGAGACTCTCCG
TGCGTGAGCAGCACCACCTTCAACATCTTCGTGTGGTTCG
GATGGGCCAATTCATCGCTCAACCCGGTGATCTACGCGTT
CAACGCGGATTTCCGCAAAGCCTTCAGTACTATTCTCGGC
TGCAACCGACTCTGCGCGTCTTCCACGGTGGAGACGGTGA
ACTTCACCAACGAGCTCGTGTCCTACCATCACGACACCAC
TCTGATGCACAAGGACGCGCAGGGAGTTTCCAGTCCGCGC
CTGGATTTGGTCCCGGGACACTGCGATCAGACGGACGTGC
CTTTCGATAAGGTATCGGTCGTGTCCAATTCGTCTCGTGT
CCAAAGAAGCGCGCTGCTGCCGCAGGACGCAGAGATGGAG
ATCTGCCTGGACATGATGCCCTTCACCTCTGCTGGACTCA
GCGACTGCTGTGCGATTCCGGGACAGATTGAGGAGTGTTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations