Transcript

si:ch211-196h16.12-201

ID
ZDB-TSCRIPT-121213-691
Name
si:ch211-196h16.12-201
Previous Names
  • ch211-196h16.12-001
  • si:ch211-196h16.12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052608 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052608|OTTDARG00000036930|ZDB-GENE-121214-351 si:ch211-196h16.12|OTTDARP00000041353 CH211-196H16.12-001 LG_ AL929150.13 Danio rerio protein_coding NOVEL, 517 bp
TCTGACCGTCGTTCCAGCGTTCTGTTTCTCAGTGATGTGC
AAGGGGCTGTCCGCCATCCCCTCCTCATGCCTGGAGAAGG
CGAAGGGCATGAGGGTCAAACTCTCCCACCTGGCCGAAAA
ACAGGACAAACACAGAGTGAATGAGGAGAAGCCGCCGCAG
GATCTGGAGTCTCTGCTCAGCAGTAAACTGGGCGTTCAGG
CTTTCCGCTGGTTCCTGCGCTCGGAGTTCAGCGAGGAGAA
TCTGCAGTTCTGGCTGGCCTGTGAGGAGTACAAGAGCTCA
TCCGGAGCCAAGCGCATCTCCAAAGCCCAGCTGATCTACA
AGCAATTCATCAACCCTGACGCTCCACACGAGGTGAATCT
GGACAGTGAGACGCGTGAGGCTGTGATGCAGCTGATGGAG
GAGCCGGCGGTGGACACGTTTGATGAGGCTCAGCTCCGCA
TCTTCACCCTGATGGCCAAAGACTCGTTCCCTCGATTCCT
GCGCTCGGCCTACTGCCACTAAAGCACTCTCTGATCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations