Transcript

r3hcc1l-201

ID
ZDB-TSCRIPT-121213-690
Name
r3hcc1l-201
Previous Names
  • r3hcc1l-001
  • ch211-196h16.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052605 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052605|OTTDARG00000036928|ZDB-GENE-030131-4156 r3hcc1l|OTTDARP00000041350 CH211-196H16.10-001 LG_ AL929150.13 Danio rerio protein_coding NOVEL, 1704 bp
GAAGCATTTTTGAATGTGACGTCACGGCGCCGGTACGTCT
CCAAACATCCGGTCATGGTTTCAACGGTTTGGCGAACTGA
AAAATATTAAGACATCCTGATGGAGACCGAAGCAGCTCAG
CCTGAACAAGGCTCCAAAACTGCTGTCCCGGCCCGAACTA
AAAGGCCCACCATGGAAGTCTACGTTCCCAAGAAACGGCA
GGCCGAGAAAACAGACAAACCTCAGTCAGACGGTGACAAG
AAATCCAAACCCAGACCTCGATACACAGATAAAGCCCGCA
AGAACAAGAAAGATAAAGCCAAAGTGAGCGAAACCCAAAA
CGGAGAAATTAAACCAGATGCTGGAGAACAAGGAGGAGGA
GGAGATACAGAAAACCAAAACACTGAACCAGAAAAAGATG
AAGAGTCCACAGGAGACATGAACACCACATCCAGAACTGT
GCACTCCCCAGAAGACTCGAGCAGTGTGCTGGAACATGAT
GACGAGGAGATGAAGGACGAAGAGGAGAACTGGGATTCGT
TATTTAATGACGACGGAGACTGTCTGGACCCCCATTTGAT
GGAGGAGATGTCTCTAAAGGAAGGACGCAAGAAGCAGTCT
GCACAGGACTCAGGCTTCGACTACTATAATTGGTCGCCGC
AGGATGACGAGGAGGTGGAGCTTCGGGATGACGAGCTGTC
ACACATCATCGAGATTTATGATTTCCCAACCGAATTCAAG
ACGGAGGATTTGGTCAGATCCTTCAGCTCCTTCCAGCAGA
AGGGCTTTGACATCACGTGGATCGACGATACACACGCTCT
TGGTCTGTTCTCCAGTCCTATCGCTGCTCGTGATGCTTTG
AGGATGAAGAACCCCATGATGAAGGTCCGACCTCTGTCCA
GCTCATCAAACGCCACTAAAGCCAAAGCGCGCAGCTGCTC
CGATTATCTGCTGCCGGCTAAAGAGCGTCCTCAGACGAGT
GCGGCTTTGGCACGGCGGCTGGTCATCGGAGCTCTGGGCG
TGAAGAGCAACCAGACCCGGGAAGAGCGAGAGGCAGAGAG
GAACAAACTACAGCAAGCCAGAGAGCAAAAGCGTTTAGCC
GCTAAGCAGCGTGAAGATGCCTGGGAGGGCAAGTGAAGAT
ACAGTTGTAGGAGCTTCACAGGTTCAAGAGACGCCTCGGT
GGATCAGGACTACTGCCAAACCAGCATGGACTGAACCAAA
GCCACAGGGACAGGGGCTCATCCAAACAGGGAGATTTTGT
AATTTTTCTATCCTCTTGAAAGAACTTTTCCCCGTAAATG
TTTGATTGTTATAGGGTTTGGTTTGGACCTGCAATTTTAA
TGTTTTTTTTTAAATGCAATTTTTTTTAGAGAGAGAATGT
TTTATTGAGTAAATTAAACTAGACCATGGCAATATAAATC
AGTTTTATTTTGTTTTTGGATCTTTTTTTTTTTATTTGGA
CTTTGTATATGCGTGAATCAGAAAAAAATCTGTCACATTT
CATAGTAATGAAGCAAAAATAACATTTATGGGGAAAATTA
TTAAGAGCTCTGAACTGGTCAAGCATTACAGTAATGTTTT
AACCCACAGTACCATACATTGTGGATTTTTCAGCTAAAAC
CTGCATTAAAGATCATTGTGCATATTATTTTTGTCAACCA
AGGCTTTGTAAACCATCGGCACATTCTAATACCAAACTTC
CTGTATATGTTATTTAGATGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations