ZFIN ID: ZDB-TSCRIPT-121213-668
Transcript Name: fscn1b-201
Previous Names: fscn1b-001, ch211-160d14.13-001, si:ch211-160d14.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047337 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047337|OTTDARG00000033628|ZDB-GENE-120507-1 fscn1b|OTTDARP00000037194 fscn1b-001 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 3781 bp
CCGAGCTCCAGCATGTCTTCAGAGGGAATAGGCGAGACGC
TGGTGATTCGGTTCGGCCTGATAAATGCCGATAACAAATA
TCTGACAGCGGAGATGTTTGGTTTTAAAATCAACGCCTCC
GCGAGCTCAATGAAGAAGAAGCAGGTGTGGACGCTGGAGC
AGTCCGGGGACCACGGAGACTCCAATGCTGTGTTCATCAA
AAGCCACTTGGGTCGATACCTCGCCTCCGACAAGGACGGC
AAGGTGACCGCAGACAGCGAGCAGCCCGGCCCGGACTGTC
GGTTCCTCGTGATCGCCCACGACGACGGCCGGTGGTCCCT
GCAGTCCGAGCCCCACGCGCGCTACCTGGGCGGGACCGAG
GACCGGATCGCGTGCTTTGCGCAAAGCATCTCTCCTGCGG
AGAAGTGGAACGTGCACCTGGCCGTGCACCCGCAGGTCAA
CGTGTACAGCATCGCGCGCAAACGGTACGCGCACCTGTGC
GCCGATAGGAATGAGCTCGCCGTAGACCGCGACGTGCCGT
GGGGTGTGGACTCGCTGCTCACACTCGTGTATCTGGACCA
CCGCTATCACCTGCAGACCGCTGACAACCGCTTCCTCTCG
TGCGGCGGAACCCTGACAGCCAAACCAGACCGGGACACCG
GCTTCACGCTGGAATTCCGCGCGGGTAAGGTGGCTTTCCG
AGACGCCACGGGAAAATACATCGCGCCTACGGGCCCCACC
GGGACCATGAAGTCGGGCAGGAGCGCGCGTGTTGGCAAAG
ATGAGTTGTTTGTCCTCGAGCAAAGTCACGGGCAAGTGGT
GCTCACCGCCAGCAATGACAGAAACATCTCCATGCGCCAG
GGAGTTGATTTATCAGCCAATCAGGATGAGGAGTCTGATC
AGGAGGTGTTTCAGATGGAGATGGACAGAGAGAGCAAGCG
CTGTGCCTTCAGGTCTTTCAATGGGAGATACTGGAGTCTC
ACCTCGAGTGGAGCCATCCAGTGCTCTGCTTTAACCAAAT
CTCCCAGTTGTTTCTTCGACCTGGAGTGGAAGGGCTCAAA
AGTGGCACTGAAGGCCAGCAATGGCAAATATCTGGCAGCC
AAGAAGAACGGACAGCTGGCAGCCGCGGTGGACTCTGCAG
GCGAGCAGGAGGAGTTTGTGTTGAAGCTCATCAACAGGCC
GCTGATTGTGTTGCGCGGTGAACATGGCTTTATTGGCTGC
CGCAAACAAGGAACCGGTACACTCGATTCCAACCGATCTT
CCTATGATGTCTTCCAGTTAGAGTACAACAACAATGCATA
CAGCCTCAGAGACTCCGTGGGGAAGTACTGGACGGTGGAG
TCAGACGGCTCTGTGATCAGCAGTGGTGCGGCTCCTGTCT
ATTTCCACTTTGAGTTCTGCGATTTTAACAAAGTGGCTAT
TAAGACGAAGGAGGGCAAATATCTTAAGGGAGACCACGCT
GGAGTGCTGAAAGCCAGCGCTCAGGGGATTGCTGATGCCA
CATTGTGGGAATACTGAGAAACATTTATGAAGCCACACAG
ACAAACAAATGTGTGCTCCTTTCAATATTCCAACTAAACA
CATCCTCTATAGCACAAGCAGACAGTCGTCATATCACACA
ACACAATTACATTACATCTCAACATAAGTCTTCAAGGCAC
AAAAACACATTTGAATGTAAAAGTACAAACAAATGCACAA
ACGATTTGTCTTTGGTTTAAAGGGGTAGTTCACTCAGAAA
TCTACATTCTGTTTTTATTTTTTTTTCAAACTTGAGAATC
ACAAATCAAGATATGTTTACTTTTATGGAGCCAGATCAGT
CTCAAAAATAATACGTTTGCAAAATACAATTCATACACAA
TTCACATTTACAACATGTAATTTGTAAATTTAAAAGGCAA
TTCTTTAATACACAATTCCAATTCATAAATTTAAAACACG
ACTCGTAAATACACAAATCCAATTAATAAATTCAAAACAA
GATTCGTAAATACACAAAACACAATTAATCTAATTAAAAC
ACTATTCGTAAATACACAAAACACAATTCGTAAATTAAAA
ACACGACTCGTAAATACACAATTCATATATTCAAAACATG
ATTCGTAAATACACAATTCATATTTTCAAAACATGATTCG
TAAATACACGAAACACAATTCGTAAATTCAAAACACAATT
TGTAAATTCAAAACACAATTTGTAAACTCAAAACATGATT
TATAAATACACAAAACACAACTCGAAAACATAATTTGTAA
ATTCAAAACACGACTCTTAAATGCACAAATCCAATTAATA
AATTCAAAACATGATTCGTAAATACACAAAACACAACTAA
TCTATTCAAAACACAATTCGTAAATACACAAAACACAATT
CATAAATTCAAAAGACGGTTTGTAAATGAAGAAAACGCAA
TTCATAAATTCAAAACACAGTTTTTAACTACACAAATCCA
ATTCGTAAATTCAAAACATGATTTATAAATACACAAATCC
AATTCGTAAATTGAAAACACAATTCGTAAATACACAAAAC
ACAATTCGTAAAATCAAAACAGTTCATAACTATGCAAAAC
ATAATTACAAAATTTTAAACACAATTCATAAATATACAAA
CCCAATTAGTAAATTCTAAGCACAATTTGTTTGTAAATGC
ACACATCCAATTCAGTTGGGGAAATATTTATTTGTGTTTA
TGATTTTATGAAACATTTACAGTATGATTTGTAAAATTGT
GTTTAGATTTTTACAAATTGGATTTGTGTATTTACGAATT
GTGTTTTGAAATTACTAACTAGATTTTGTAGATTTGAATT
ATGCTGTGCATGTACAGTATGAGTTTTGTTTTTGCATATT
ATTTTTGAGACTGATCTGGCTCCATACTTTTTTCCATAAT
CGTTTTTTGTTGTTGTTTCAAATAAAGAAAGTTAATTCAT
GTTTGGAATGATGCGAGGAAATGATGACAGAATGTTTACT
TTTAGGTAAACTGGCCCTTTAAGAGAAGCACAAGCTATAG
TATTTTTAAAATTATTGTCACACAAACTCCTAATGTGCTT
TGCTCAATAACAGATTAAGATAAGTTCCTAAAAAGGAGAA
ATACTAATTTAGACTAAGCAATTGAATGCACTTTGTATAT
AGGCTCATGCAAAGTCACTGTGTCTGCCTCCCAGGGGCTT
TCATGGCCTTATTTTACTCAATAGCTGCTTCTAAGAAATT
CAAAATCTAGATGTTGTTACATAATGGACAATAATTTGCT
TATGTAAAATGGGCGTAGATCCGTGTCTCATAAGCTGAGC
CTTTGGCCATAGGTTTTGTTCTTGCTCCCAAAAACATTTT
TAGCGTGAGCTGGCGTCTGTAATGAGGCCAGGATTTAAAT
AGCAGCATCACGGCTCAGAAAATACAGGAGAAAAATACAC
GTTCACATTAGAGAGATTCAGACTTCACACACACACACTC
AAAAGCAAATCATTTGTCTGTCAATTTTGTAGTGTTTGTG
GCCATTTTCAATGACAAGATTTGTATTCAGCGCTGTTCTG
GCTACAGGAACTAAAGCGCTTTTTTAATGTAACTCCGGCT
TATTGTTGATAACATGTTGATTTGCACTCTTTTTCGGCTA
AAGCTTTTTCATGTGAAAGTGTTGAAGATTAAGATGAAGT
GTTTGTGCCTTCCTTGGTGAGGTCAGATCCCCTAAGGTGT
GAAAATGCAGTTATTTGAACTTTTTTATTTCTTATTTTAT
TCTCATCATGTGTCATTTGCAACTGGATATGACAATGAAA
CTAATAAAAATGTCAGAAAGT

fscn1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fscn1b-201 3781
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fscn1b-201 Contained in:
[BAC] CH211-160D14 (1)

Genome Resources: Vega_Trans:OTTDART00000047337 (1),  Ensembl_Trans:ENSDART00000054989 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE210741 (1) 513 nt
CITATIONS (2)