ZFIN ID: ZDB-TSCRIPT-121213-626
Transcript Name: hist1h2a4-201
Previous Names: ch211-113a14.1-001, zgc:114037-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032998 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032998|OTTDARG00000025086|ZDB-GENE-050731-6 zgc:114037|OTTDARP00000026685 CH211-113A14.1-001 LG_ CR354435.20 Danio rerio protein_coding KNOWN, 482 bp
TTTATTCTTGCTTCTACTTTGAAAGTAAAATAGTCTCAAC
ATGAGCGGAAGAGGCAAAACAGGCGGTAAGGCTAGAGCCA
AGGCTAAGACTCGCTCATCCAGGGCTGGACTGCAGTTTCC
CGTTGGCCGTGTTCACAGGCTGCTCCGCAAGGGTAACTAT
GCTCAGCGTGTCGGTGCCGGTGCTCCAGTGTACCTGGCCG
CTGTGCTCGAGTATCTAACTGCTGAGATCCTGGAGTTGGC
TGGAAACGCCGCTCGGGACAACAAGAAGACCCGCATCATC
CCCCGTCACCTGCAGCTGGCGGTGCGCAACGACGAGGAGC
TGAACAAGCTTCTGGGTGGAGTGACCATCGCTCAGGGCGG
TGTACTGCCCAACATCCAGGCTGTTCTGCTTCCCAAAAAA
ACCGAGAAAGCAGCCAAAGGCAAATAAACCGCTGCAGCTT
GAACACAACCACCCCCCCAAAGGCTCTTTTTAGAGCCACC
CA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hist1h2a4-201 Contained in:
[BAC] CH211-113A14 (1)

Genome Resources: Vega_Trans:OTTDART00000032998 (1),  Ensembl_Trans:ENSDART00000073404 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC098891 (1) 530 nt
CITATIONS (2)