ZFIN ID: ZDB-TSCRIPT-121213-589
Transcript Name: cyth3a-201
Previous Names: cyth3-001, cyth3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058110 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058110|OTTDARG00000040476|ZDB-GENE-120612-1 cyth3a|OTTDARP00000045500 cyth3-001 LG_none BX548001.17,CR932017.9 Danio rerio protein_coding KNOWN, 3275 bp
AGAGTCTCAATGGATGAAGGCGAGTGGAAGCTGGCGTAGA
GCGGTCTGCATATTCATTTGCTTCACAAGGATTTATGTCC
ATCTATTCAGCAATTTATGGATTATGCGAATGACATTTTG
ACCAGCCCCTGAACTGGTTTACGATGAGCCCAATGTGTGT
CCTCCTAATGTGATTAATTTTTTTTTTTTTTGGTTTGTTT
TTGTGTTTGTTTCACAAAACAGTGCTAAGGGTAGCCTAGT
AATCTTAGTATAGGACGTTATTTACATCAAGTGTCTTCGC
AGCATGAACATGGATGAAGACAACCGAGTGCCGGAAGATC
TTTCCTTTGAAGAGAGAGATGAACTGTCCAATATTAGAAG
GAGGAAAAGGGAGCTACTGGATGACATTGAGCGGTTAAAA
TTAGAGATCTCTGAAGTCATGACCGAGATTGAACATTTAA
CGTGTGTCAGAGAGACTAAAAGCACTCAGAGGAGCAAGCA
GATTGCTGTTGGAAGAAAGAAATTCAATATGGACCCTAAG
AAGGGAATCCAATTTCTTTTGGAGAATGATCTTCTGCAGC
ACACACCTGAGGACATCGCTCAGTTCCTCTATAAAGGTGA
AGGCTTGAACAAAACTGTCATAGGAGATTATTTAGGAGAA
CGAGATGACTTCAACATTAGGGTTTTGCAGGCATTTGTGG
AGCTTCATGAGTTTGCTGACCTCAACTTGGTGCAAGCATT
GAGGCAGTTTTTGTGGAGCTTCAGACTTCCCGGTGAAGCA
CAAAAGATTGATCGAATGATGGAGGCCTATGCTGCTCGAT
ATTGCCAGTGTAACCCTGGTGTCTTTCAGTCAACAGACAC
ATGCTACGTTCTCTCGTTCTCCGTAATCATGTTGAACACC
AGCCTGCACAATCCTAACGTCAGAGACAAGCCCTCAGTGG
AGAGGTTCATCTCCATGAATCGAGGCATCAATGAAGGAGG
AGATCTGCCTGAGGAGCTGCTCAGAAATTTATATGAAAGC
ATTAAAAATGAGCCCTTCAAAATTCCTGAAGATGATGGGA
ACGATCTAACTCACACCTTCTTTAATCCAGACCGAGAGGG
ATGGCTGCTAAAACTAGGGGGAAGAGTGAAAACCTGGAAG
AGGAGGTGGTTCATTTTGACAGACAACTGTCTGTATTACT
TTGAATATACTACAGACAAAGAGCCTCGGGGAATCATTCC
ACTGGAAAATCTTAGTATAAGAGAGGTGGAAGAGCCAAGA
AAACCAAACTGCTTTGAGCTCTACAACCCGAGTCATAAGG
GCCAGGTAATTAAAGCATGCAAGACGGAGGCTGATGGGAA
AGTAGTGGAGGGGAATCACGTGGTGTACAGAATATCAGCA
CCCACGCCGGAGGAGAAAGAAGAGTGGATCAAATCCATCA
AGGCCAGTATTAGCAGGGATCCATTCTACGACATGTTGGC
TACTAGAAAACGGCGAGTGGCCACTAAAAAGTGAAGTGAA
AACCTACATCCGGGTTTTAATAATCACTTTACAACGTTCA
CCCTGGAGGAAATGGACACACGGGGACAAGAGCAAACTGA
GGAGAAAGAAGAACAAGACTTTAAAAATATTGGCGTCTCT
ATGAATCAAGTGCGAAACTGAGGGATGTGTACTAAATAGT
TTTCTCCATATGACTTGTATGGCGAATCGAGTGAAGATGG
TGTGCTTATATGTTGAATGTTATAATGAATGTTTTAACAA
CGCTTATAATGTCTGTGTGGGTTCAGTAGAGAGTGAATAG
CGCCCCCTGCCGCCTTTAGCAGGATAGTTACAGGACATTT
CAATTTGAGATGGCCAAGAAATGTATGTAAAATAGAGTGA
ACTACTAATAATGATGTCTTTTTGGTTTTCAGATAAATAC
AGGAGATGAATAGTTGCAGGGAATCATGCTGAATATAGAT
TTGTGCCGTCATAATATCGAATAATATTCATTATCTTAAT
TGCATTGGTCGTCTTAAATGGTTTTATGTTCTGTTGTTGT
GTACACAGTCATCTAAATCAGCAGGACTGGTTGCATTAAC
TGCATTAACAATCAAAAGTTATATTTATTATCTTTTTTGT
TGTTCTTAATATAAAACACTGTAAAAATCCTCTTTGATAA
TGAAAATATTATTAGATGCCTTTTCAGAAAATGATACAAG
CTGTACTTCTGTTTCGTATTCCTATTTTGGTTTGAATAAT
TTGACTGTTTTGTTGTATTTATGTAGTCTAATATTGCTGT
TGTGTTGTTTTGTTTTTACAGTTTGTAATATAACTCACAA
AAGAAGACCACAAAAGCTATTCTTCTTTTCCATTTGAAAC
TTTTTGGATTTAAAACTAATCTATATGCAATTTTTATTAA
TCAGCTTGGATATTCTAAGTCAAAGAAACTCATAATTCTA
CTGGTTTATTGCAAAGATTCTGATATATCTCTGTGGTTAA
AATATGAATCAATTGATACGACTCAAATGAAATGTTTCCC
TAATTTTCTATTATTTCTGCTGTAAAGTGAACACAGACTC
TGGTGCCTGTTTTCGTGCAGCCTTATAATCAGCAAAAACA
TATGAAAACAATTGGACAAATACATTCCACAAACACTGTC
TATTCCTGTTAGCACCAACCTAAGCCATAGCAGCAATGTA
ATCCATGCCCATTTGAAAACTGAATTATTTTATGAAAACT
GTAGTTTTTATGTGATAATTTAATTTGTAAATATCCTCAT
ATTCTGTTGTTATGGTAAATATGCAGCATGCTTATATACA
GTTGTCTTTCAGAGCTTTCTGTATGTGTCAGTAAATCATA
ATTCCTATATCTCAGATGGGACATGGATACGGGTTGTCCT
GTCAGTGAAGCCAGTGACCTCAAGATCTGATCTGATTAAA
GATTTTTTTTTTTGTCTCGAGATTCACCAGGGATTTGACT
TCATTACATTAAAACACACTAGTTCTTTCATACTATATGG
AAGTCAGTTGGTATAAGCTACATGCTTTAATGTTTCTTGA
ATGTGGATAAATGACAGAATTGATGTGAGATGATTCCTTT
CAGATTTTCAGTGAATAAATAATAATACAATACTGAAGAC
AAACTAGTGTTTCAGCCAGCTTGAATTATTATAACTATTA
ACTGAACCTTTTTTGGGTAGCCATAAACTAAAAATATATT
CTGTTTTCTGTTTAGCATAAGAAACTCACCTAGGTTTGGA
AAAACATAAAGATGATACATAATTACGGACATTATATATA
CAGTTGAAGTCAATATTATTAGCTCCCCTTTGATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyth3a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058110 (1),  Ensembl_Trans:ENSDART00000020628 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT725187 (1) 873 nt
GenBank:CT683195 (1) 827 nt
GenBank:DV595470 (1) 765 nt
GenBank:EB851901 (1) 492 nt
GenBank:EB980067 (1) 399 nt
GenBank:EE212522 (1) 227 nt
CITATIONS (2)