Transcript

si:dkey-26g8.4-202

ID
ZDB-TSCRIPT-121213-582
Name
si:dkey-26g8.4-202
Previous Names
  • ctsl1b-002
  • ctslb-002
  • dkey-269i1.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058086 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058086|OTTDARG00000040458|ZDB-GENE-980526-285 ctslb|OTTDARP00000045483 DKEY-269I1.1-002 LG_ BX322603.16 Danio rerio protein_coding NOVEL, 308 bp
AGTCAGTAAGGTTTGCTTGTGAAAGACATCCAGTTAGACG
ACCACTGGAACTCCTGGAAGAGCCAGCATGGAAAAAGCTA
TCATGAGGACGTAGAGGTCGGGAGGAGAATGATTTGGGAG
GAGAACTTGAGAAAAATTGAGCAACACAACTTTGAGTATT
CCTATGGAAATCACACCTTTAAAATGGGAATGAATCAATT
TGGTGACATGACAAATGAGGAGTTCAGACAGGCAATGAAT
GGTTATAAGCATGACCCCAACCGGACGTCACAGGGCCCGT
TGTTCATGGAACCCAGCTTTTTTGCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations