ZFIN ID: ZDB-TSCRIPT-121213-581
Transcript Name: si:dkey-239j18.3-201
Previous Names: dkey-239j18.3-001, si:dkey-239j18.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058083 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058083|OTTDARG00000040456|ZDB-GENE-121214-39 si:dkey-239j18.3|OTTDARP00000045480 DKEY-239J18.3-001 LG_ BX465840.13 Danio rerio protein_coding NOVEL, 1150 bp
AGTCTTTCAGGCAGGATGATGTTTGCTTTGCTCGTCACGC
TTAGCATAAGTGCAGTGTTTGCTGCTTCATCTATAGACAT
CCAGTTAGATGACCACTGGAACTCCTGGAAGAGCCAGCAT
GGAAAAAGCTATCATGAGGATGTAGAGGTCGGGAGGAGAA
TGATTTGGGAGGAGAACTTGAGAAAAATTGAGCAACACAA
CTTTGAGTATTCCTATGGAAATCACACCTTTAAAATGGGA
ATGAATCAATTTGGTGACATGACAAATGAGGAGTTCAGAC
AGGCAATGAATGGTTATAAGCATGACCCCAACCAGACATC
ACAGGGCCCGTTGTTCATGGAACCCAGCTTTTTTGCAGCC
CCACAACAGGTTGACTGGAGACAGAGGGGCTATGTTACTC
CTGTCAAAGACCAGAAACAATGTGGATCTTGCTGGTCTTT
CAGTTCAACGGGTGCCTTGGAAGGTCAGCTCTTCCGTAAA
ACTGGAAAGCTGATTTCTATGAGTGAGCAAAACTTGGTGG
ACTGTTCCAGACCACAGGGCAATCAAGGGTGTAATGGAGG
CCTCATGGACCAGGCCTTCCAGTATGTTAAAGAAAACAAG
GGGCTGGATTCTGAGCAGTCATACCCTTATCTTGCAAGGG
ATGATCTGCCATGCCGGTATGACCCCCGTTTTAATGTCGC
TAAAATCACCGGATTCGTGGACATTCCCAGCGGTAATGAG
CTTGCCCTAATGAATGCTGTTGCAGCTGTGGGTCCTGTAT
CTGTTGCTATTGACGCATCACATCAATCCCTACAGTTCTA
TCAGTCTGGCATCTATTATGAGAGAGCATGTAGCAGTAGT
CGACTTGATCATGCAGTCTTGGTGGTTGGCTATGGTTATC
AGGGTGCTGATGTTGCTGGGAATAGATACTGGATTGTGAA
GAACAGCTGGTCTGACAAATGGGGTGACAAAGGCTACATC
TACATGGCAAAAGACAAAAACAATCACTGTGGCGTTGCGA
CAAAGGCCAGCTATCCCCTAATGTAAGGCCACTGGAGCCT
TCTCTGCATTCTGAAAAAGTCCCGTTTATGGTTTCTCTAT
TTTAATGTGTTTTTATTTCTTCTATTTTATCAAGTTTTTC
TGCTGTTAGTGCTATGATAGTGGTATTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-239j18.3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058083 (1),  Ensembl_Trans:ENSDART00000128811 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT598145 (1) 920 nt
GenBank:CB360646 (1) 548 nt
CITATIONS (2)