Transcript

si:dkey-239j18.3-201

ID
ZDB-TSCRIPT-121213-581
Name
si:dkey-239j18.3-201
Previous Names
  • dkey-239j18.3-001
  • si:dkey-239j18.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058083 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058083|OTTDARG00000040456|ZDB-GENE-121214-39 si:dkey-239j18.3|OTTDARP00000045480 DKEY-239J18.3-001 LG_ BX465840.13 Danio rerio protein_coding NOVEL, 1150 bp
AGTCTTTCAGGCAGGATGATGTTTGCTTTGCTCGTCACGC
TTAGCATAAGTGCAGTGTTTGCTGCTTCATCTATAGACAT
CCAGTTAGATGACCACTGGAACTCCTGGAAGAGCCAGCAT
GGAAAAAGCTATCATGAGGATGTAGAGGTCGGGAGGAGAA
TGATTTGGGAGGAGAACTTGAGAAAAATTGAGCAACACAA
CTTTGAGTATTCCTATGGAAATCACACCTTTAAAATGGGA
ATGAATCAATTTGGTGACATGACAAATGAGGAGTTCAGAC
AGGCAATGAATGGTTATAAGCATGACCCCAACCAGACATC
ACAGGGCCCGTTGTTCATGGAACCCAGCTTTTTTGCAGCC
CCACAACAGGTTGACTGGAGACAGAGGGGCTATGTTACTC
CTGTCAAAGACCAGAAACAATGTGGATCTTGCTGGTCTTT
CAGTTCAACGGGTGCCTTGGAAGGTCAGCTCTTCCGTAAA
ACTGGAAAGCTGATTTCTATGAGTGAGCAAAACTTGGTGG
ACTGTTCCAGACCACAGGGCAATCAAGGGTGTAATGGAGG
CCTCATGGACCAGGCCTTCCAGTATGTTAAAGAAAACAAG
GGGCTGGATTCTGAGCAGTCATACCCTTATCTTGCAAGGG
ATGATCTGCCATGCCGGTATGACCCCCGTTTTAATGTCGC
TAAAATCACCGGATTCGTGGACATTCCCAGCGGTAATGAG
CTTGCCCTAATGAATGCTGTTGCAGCTGTGGGTCCTGTAT
CTGTTGCTATTGACGCATCACATCAATCCCTACAGTTCTA
TCAGTCTGGCATCTATTATGAGAGAGCATGTAGCAGTAGT
CGACTTGATCATGCAGTCTTGGTGGTTGGCTATGGTTATC
AGGGTGCTGATGTTGCTGGGAATAGATACTGGATTGTGAA
GAACAGCTGGTCTGACAAATGGGGTGACAAAGGCTACATC
TACATGGCAAAAGACAAAAACAATCACTGTGGCGTTGCGA
CAAAGGCCAGCTATCCCCTAATGTAAGGCCACTGGAGCCT
TCTCTGCATTCTGAAAAAGTCCCGTTTATGGTTTCTCTAT
TTTAATGTGTTTTTATTTCTTCTATTTTATCAAGTTTTTC
TGCTGTTAGTGCTATGATAGTGGTATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations