Transcript

mmachc-202

ID
ZDB-TSCRIPT-121213-548
Name
mmachc-202
Previous Names
  • mmachc-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057984 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057984|OTTDARG00000010950|ZDB-GENE-030131-3167 mmachc|OTTDARP00000045411 mmachc-002 LG_ CR854946.2 Danio rerio protein_coding KNOWN, 1063 bp
GATCTCCAGTGAACGCGTGGAGGAGCTTCTCAGGACTTTC
CGCGAGTCTTTAAAAGCGAAAGGTTTTGAAATCTACCCCT
TTAAGGTATCGCAGACAGATCCACCAATAATCCAGCTAAC
AGCTTTGGTGTGTGTCGCATGTACTGCATGTTGAATCAAT
GTGAATCTGCAGTTCTGTTCATCTTTCCGAGAGAGTTCAT
TACTGAAAATGAAGACAACAGAAGGGAATTTGCTGATCTG
TTAAGCCCTCCATGTCCAGGTGGGCTGGTATAATGCAGTG
CTCACCGCTGCTCATCATCTGCAGTATCCAGCAGACACTC
TGGCTGTGCTGGTCATCAGCACTCCTGCCATGTTTGAGTG
TGCATTCCTGCCCTTCTTACAGAGCCAGAGCTGCGAGAGC
CTCAGAGACCCCATAGACCAGTGCACGGCACACACACTGT
CTGCCTGCATCTCTCTGTGTTTCGCTAATCAGTTTGTGGA
TGTCAGCTACGACTATGAGATGCTGCCCAGCCGAAAGCCC
AAGTTTCTTGCCCAGACTGCAGCCCATGTGTCAGGAGCAG
CGTATTACTATCAGACATCAGACATCCACAATCCGCCATG
GGGAGAGAAGAAGATGTTTGGAGTTTGTGTCCACCCTCAG
CTGGGCGGCTGGTTTGCGATCCGTGCGCTGCTGGTGTTCA
GAGATGTGCAGGCGGGAGCAGGTTTTCAGCAGAGGGATCC
CGCAGACTGTGTGTGCACGCAGGAGGAGCGCATACGGCTG
CTGGAGAGCTTTAACCTCCGCTGGCGGGACTGGAGCTACA
GGGACATCGTGCCCGCAGAGGATCGCTACTCGGACCAGCA
GAAGCAGTATTTCATCACTCCACCAGGACAGCGGAGGGCG
CTGCTCAGACAGTGGGGATACCTGACCGACACGCAGAGCT
GATCAAACTAACTATTATTGTGGTCTCTGCTGAACGACTT
GTATGTTGACTCTGGGAACAATGTAATTAATTGCACAATA
GAAAACAAATGTATATATATTTTTTAATTTAATTTAATAA
AATTGCGGGAAAGTGTTTTAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations