Transcript

mki67-201

ID
ZDB-TSCRIPT-121213-518
Name
mki67-201
Previous Names
  • mki67-001
  • ch211-250b22.7-001
  • si:ch211-250b22.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057805 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057805|OTTDARG00000040274|ZDB-GENE-030131-9771 mki67|OTTDARP00000045289 CH211-250B22.7-001 LG_none CR848037.16,CU104767.8 Danio rerio protein_coding NOVEL, 8187 bp
CTCATATCCGTCCGCAGTTTGACAAGGAAGGTAGTCCCTC
AATTTTATGAAGTAGTATACGCTAAATTTTGTTTTCAAAC
ATCGTGTATACTGTTGCATTTTTATATGCTTTGTACAATT
TTTTAAAATCAAAGTAAATAACTGTAAGTTGTTTTTAATG
TTTTTGCGGAGGGATATTTTACGGTCAGACGAAATGGCAA
CACGCGCTGCTTCTTGTGTCTGTGGATAGTGTTGTTAATG
TTAGTGCTAGTAAGAGCAGCTAGTAACGGCTGGAGCGATC
AGTGAGATATCGATGGAATATATTTTATTGTTTTGATCTA
CGGAACCTCAGGTAAGTTTTAATATGCCTTTGCTGGGAAA
GATTGTGGTGATCAAGAGAAATGGAGGAGATGGCACCGAA
TTCCCCCTCACTGCGTCCTGTCTTTTCGGAAGGAAGATGG
ACTGTGATATTCGGATTCAGCTGCCGCAGGTATCGAAAGA
GCATTGTAAAATTGAGCTGAATGAGAACAAAGAGCTCATT
TTGACCAATTTGAGCTCTGTGAACCCAACACGTATAAATG
GACAAGTCTTTAATCAGTCAGAACGTTTAAAGCATGGTGA
TTTAATAACAATCATTGATCGTTCTTTCAGGTTTGAGTAC
CCACCTCCTAAAACACCGAAGAAGAGGCTGTCTGGAAAAG
ACAAAACTGTTCAGGCTTTGCAAGAGCAGCAGGAAAAAGG
CACACCTGTGCCTGTGGAGAAGAGGAAGTCAGAGCATTCC
TTTGACACTTGTTTAAAAGATGGTTCAAACTTGCCACCTA
CTGTGGAACAAACTGCCGAGGCAGAGCCAGAAGATGCCAA
ACTTAAAAAGGAAAGTATGTCCCCTTTTTGTGAGCTCTAC
CAAATGGTCAAACAAGACCTTGTTGCTAAATCACCTTGGA
GGTCAGAGCAACCCAAAACACCTCTTGCAAGGTCTCAGCG
TCATGAGGAAAGTCTCACTGCAGATGCAAAGAGTACTCCT
AAACAGCTCACAACCCCTTCTACCAAGAAGCGAAGATCCT
CAAAATCCAGTTCTGATGATGCTACTAAATCAACAACCCC
TCAGAGTTCATTTCATACAAATCTGGAAGATGTTACCTCT
GCAGGTGTCAAAAGTACGTCTAAACAGATAACGCCATCTG
CCAAGAAGCGAAGGTCCTCAAAATCCAATTTTGAAGAAGC
TACTGTACTAGCTACTCCTCAGAGCTCAGCTAATGCAAAT
CTGGAAGAGAAATCTTCTGATGATGTGCAGTCTGTAGGGT
GTAACACCCCGTCAATGACAGAGAAAAGTACAACTCCTGT
CTCCCAGAAGAGAACACCCTCGACAACGCCACATAAGTTT
AGTGCTGGTGAGGTAGTCAAGCAAATTCTCTTGGAGCCAC
AAGCTGAGAATACTCCCAAGTCCCCTAAAGGAAGGCGAAG
TGGTGGGTCACAGGATCAGAACCAGCCTCAGACTCCAGGC
ACAAATGGTAAAACCAGTGAAGTGAAATTGTCACCCAGAA
CATCTCCAAGGTCAAATGCTGGCAAAAGGTTTCAGGCCCA
AGATGTTCCGCAGGAGAATAAGGCTGCAACATCAGCTTCT
AAAAACAAAGCTGACACTTCAATTAATGGGCAGCTTCATG
GTATTAAATCCCATACAAAAGTGGTTGTCCCTCAACCAAA
GAGGAAGCGAGTGTCTTTTGGTGGTCAGTTGAGTCCAGAG
CTTTTTGACAAACGCCTGCCACCCGATTCCCCCCTTCGCC
GTGGAGCAACTCCAAGACGCAGTTTGGGACCTTCCCAGAA
ATCCCAGTCTCTTTTACGAAGAGCATCCACAATTGGTCTT
TTGGCTCTTCGACTTGATGAAATCACCACAGGGGCCCAAA
AAGCTTCACCCAAACGGTCAGTGAAGACTCCATCACCTGC
CAAAAAAACGCCTATTACCAAGGCTAAAACTCCATCACCA
AAGCAAAAATCACCATCTACTGTAGCCAAGGTATCTACAC
CAACTCCTGCTACGCCCAAGACACCTGCATCTGCTAGAAG
AGCATCAACTTCAGCAGTTGAAGCTGCAGGTGACATATCT
TTAACTGGTACACCGAGAGTGCAGGGGCGGTTTTCAATCT
CTCGCATCAGTACCCCATCACCTGTCCAGGAGGAGAAGGC
TGAAGCGTTTTTAGATGTGCCTCAGAAATATGCAACACCA
GAGATACCGTTAAAGAGGCAGAGCATGAAATCTTCTGGCA
GAAAAACTCCCAAGAGTGCACTTAAAAGTGCGCTTAATGT
GATGCGTTCAAGGCGCAGCGGAGCATCGCGGGCTAATCTT
AAAGTGTTGACCTCTTGGGCTGATATTGTGAAGTTTGGTC
AGACCAAACCTCAAATAGAAGTTGCAACTAACAAAAAACC
TACAAAGAACAACGTGGTCAGGAGAACTGTTGCTCCAAAA
CCAAAGACACCTTTGCGGAGGCTTAAGAATGATGTCAGCA
CTGGGCATGCAGCATCTCCTGCAACCATTGTCGTTGGCAA
AGCCCACATGAGAACGAACCAGTTTGTTGGTGCTGCACCT
AAAATAGTCCCCAACGTGGCACTATCCAAGAAAGACATGA
AAATGGATGAGGATTTTACAGGTGTTGCAGACATTTTTAA
GACACCAGCCAACAGCAAGTCTAAGAAGCTTCTTGTCCAG
AACAATGATGAATGTCCAGAGGTCCTTCCAGATGAGAGTT
CAGTGATGAAAACACCAGAGGAATTGGGTGAAATGATTGT
ATCTCCCTTAAGTGTTGTCTCCACTGCCAAATGTGGGAGA
TACAACAGTGAGGCAGTAACGAGACTTCTTCTGGACAATC
AGGATGATAGTTTAATGGAAGATGAAAGTCAGACAAGTAA
CAAAGACAACATTTCAGATCTAAAAATCCCATCTCTTGAC
CAAACAGAGAAAGAGCAGGCTACCTGTGAAATGGTAGTTG
AAACCCCAAAACAGAAAGCAGCTCAATCCTTGTGCCTAAC
TGGAGTCAAGCGACTGATGAAGACACCCAAACAGAGAGCT
GAACCAATTGAGGACTTGAGAGGAAAACTTCTCAAGACAC
CCAAGGACCGTAAACCTTCTCAGGAAGAAAGTCTAGAAGG
TATTAAGGAACTCCTAAAGACCCCGAAATATAGAGGAGCT
CCAGTAGAAGACATGGTTGGAGTGAAAAGAGTGATGCAGA
CCCCGAAACAGAAAAGCCACCCTGTTTTATGTGCAACTGG
TCTTCAGAGGCTTCTGAAAACACCCCAAACACCTAAAGAA
AAGTCTGAGCAGCAGGAAGACCTCACTGGTGTGAAAGAAC
TGATGAAAACACCGAAAGTGAAGGGAAAACCTGTGGAGAA
GCTGTTTGGTCTGAAAAGATTGGTGAAGACTCCTAGAGAA
AAGAGAAATCCAGTTGAAGAGGATCTCACTGGTGTTCAAC
AACTAATGAAAACACCCAAGCACAAAGGAGAGCTAGTTGA
AGATCAAATGGGTATAAAAGAGCTCATGCAGACTCCTATC
GAGAAGTCCCCCAAGCAAAAAGGAGAACCTGTCAGCAGTC
AGTCTGGCATCAGCAGAATGAAGACACCTAAAGTTAAAGA
AGCACTGGCAGAAGAAGATTTTACTGATCTTAAAGAGCTT
ATTGAAGAACCAGAGAGTAACTCTACCTGCACAGAAGAAA
TTGTGACTCTGCCCAATGAGGTAAAAGAGACTGTTGCAGT
GATGGACAGTGACTCTGCAGTCATTCCAGCTGAAGATTTT
ATTAAGGAAAGTGACAAAGAAAATGTCTGTCCAGTTGAAA
TCATGGAGATTGAAGTTTTAAAATCTGTGGATCATATGTT
TACAACTAAAGCAGTAGAATCTGTCACTGATACAGAGATT
GAGGCCAACATTCCCAAAGAAAAACTCCTAGCTCAGGCTA
ATGAGGAATCTGCATCGGTTGAAGTCATTGAAGACCGTTT
TTCTTTGAAAGATGAGAAAAACATTCAGCAGTCTGAAGAA
GTGTGCACCTCTGCTAATACCAGTGCAACAGTTGAAGCTA
ACTCAACCATTTCTACTGCTGTGCAAGAGAATGAAGAACC
AATGAAGTCTTCAATTTCCAACAAAGTTCAGCATGGCCGT
CGAGGAAGAGTGGCACAAAAAAATAAAAATGAAGTGGCCA
AAGCACCAGCTGTATCGTCATTAATTGAAGAGCATAAAAT
GACTGATCAACAGCCTTTAAGCCCTGCCAAGGGTAGGAGA
GGAAGGAGAGTTCTTGAAGTTCCTGAAATCACTGCTAGCC
CAGTCAGAAAATCAGCTCGTGGTAGAATTACTAAGCAAAA
TGATGAAGACCAACAAGAAAAGAACATTGAGGCTAGCCAA
GTGCCAGCAGATTCCATGAAAATTGAGATCTCAGAATGCT
TGCCTGTAGTTCCCAAAACCAGGAAGGGAAGAAAAGCTAA
GCAAGATGATGTTGATGTCAGTACTGGTGACCAACATTGC
TCTGATGTACCTGAAACTGAAGTGCCAATTCAAGTCCCGG
TGGTGAAACCTGGAAGAAGAAAGATGGCTAAAACTGAAAT
CAAACCTTCATCGGATGTTGATGCTGCAATTGAACCAGTT
TATGAGATAAATGCTAGTGTACCACAGGCTCCTGATGGAT
CTGCAACTGAAGAGGTAGTCCAAACACCAGTTGTGAAACC
TGGAAGGAGAAGGAAGTTGGAAAAGACCGAAAGCAAACCT
TCATCAGATGATGCTGCAATTGAACTTATTCATGATGTCA
GTGCTGATGTCCCACAAGGTCCTAATGGATCCACAGCTGA
AGAGGTGGTCCAAGCTCCTGTTGTGAAAACTGGAAGGAGA
AAGAAAATGGATAAATCAGATAGACAACCTTCAGAAGAAC
TTGAAGAGAAAACACTCGAAATTGTTTGCGAGAGTAATGA
TGCTGCACCAGAAGTTACTGAAACTATCCCTGCTACTAGA
GCTAGGAGGGGAAAGCCATCCAGAAAGGAAAACCTAAAAA
CTGAGCCAGCTCAGATATTAGATGAAGTTTTAAGCACTCC
TACTGTTGCAGTGGATGAGAAGCCACTGACATCTGCAGCA
AAATCAGGACGAGGTAGGAAGGCTAAACAAGAATCTGTCA
AGGACCAAACTTTGGATGATGAAATGGTTGATGGACAAAC
TGTGGCAGTGGCAAATGATATTAAAGAACCTGAAGCCCCT
GTAGTAAAATCTGGCAGAGGACGAAAGGCCAAACAGCAGA
AGGCTATCTTGGTTGAGGAGGTTGACCAACCTACTGTAGA
TGCTAGCATAGATTTACCTGTGACAGAAGAGCAAACTGAA
ACTGTGGTAAAATCTGTAAGGGGAGGTAGAAAGACAACGC
AGTCAAAGGTGGCTGTTTCTGTTGAAGCTGAAGAGAAGGA
TGTCAGTCTGCCTGAACAAGCAGAGGCCCCTATTCTGAAG
TCTGTCAGAAAAAGGAACGTTATTGCAAAGGAAACTGAAA
TTGATGCAGAAGTTCCTGTCAAAAGAGGTCGTCGTGCAGT
TGCAGACCCTGTACCACCAGTTGCTGTTGTGCCCAGCCGT
GGACGTAAAGCAGTTGTTAAGTCACAGCCTGAGATTACAG
AGGATGTAGCTTCACCTGAAGAGACCGTTAAGACTGTTAA
AAGCACCAGACGAAGAGCAAAAGAACCCGAAACAAAGAAA
GAAGAAAGTCCCTTGATACAGACTAGTTCTGAAATTAATG
CAGCAGTTTTGCCACTTGATAAGGTGGAAAGAGTAAGCAG
GGGAAGAAAAACAAAGGATTCGGCTAAGGACTCTACAATC
AATACATCTTCCATAACTGAGGAAGCTAATGAAACTAAAC
CCTCAAAAGCTGTCAACTGGAACCCAGATTTGGTTGCTGC
TAAAGACGTTGAAGAGTTTGAACCTACAGCAGATGTAATA
GAACCACAACTGAAGAAATCCAGAAGATTATGCAAATCAC
CATCCAAGGCATCCCCCACTGAATCAGACCAATCAACTGA
CTTGCCACTCAGAGGCCGTAGAGGGAGAGCAGCAGCAAAA
AAAGAAGACCTTCTTGTTGAAGACTCTCAAGAAGAATCTC
TGAATGTCAAGACAACGAGGAGAGGAAAGGCAGTGGCTTC
CACAGCAACCAAATCAGAGCCCAGTGAAGGTAAGGCATCA
ACTCCCCTCAAAAGGAAAAGGAATGAGGTCTTGGACATAA
ATGAGGAGTCTGTAATTAAGGAACCTTTGCCAAAGAGAAG
AGGCAGAGTAGCCAACAACGCTGATGTTGCTGAAGAGGTC
TTAAGCAAAGAAAAAATACCTGAAGCCGAACAAGACAAGA
CAGAGGCCAGTTCCAAGACTGCTAATAGAAGTGCAAGAGG
ACAGAAAAAGACAGCTCAACAAACAGATCCAGCACCTGCT
CAGACTCAAGAGCCTGTTTCTGGAACTAGCACTCGAAGAG
GAAGAGGTGTGAAAAAAGTAGAGGAAGTGGACGTCTCTAC
AGTGGCAGCTCCCGTCAGGCGCACCAGGAGGAAGTAAAGC
ACTGATCTTACAGAGTGGTCTTAATATTTTCTCTGTGATC
TCTAGTTTTAGTTTGTGTTTGTACCATTTCTTTATGGCTT
TTTTCTATTAATTTTTCTGAGTAATTTTAGCTGCTTTTTT
TTTTAGAGAAGAGTGTGTAAACTAAAATGTTTTTCATGTT
CTCTTAAACTCCTGAAAGGGGCATTAAAATGACAGGCGAA
CATGGTTTTACTTTTAAGAAAATATTTTACAACTGTTTCA
ACTCTTGAACTGTTAACCTTTCACAGACACATTTTATCAT
CTATATTCCCTTCATGTTCTTTTCTTTTTGTACTGTATTA
AAAATAAAATAATTGAGGGGTGCAAAATCAGGCTTTTACA
GTTGTTGAGCCTAAGAGTATGTAATGTGGCTTTCTGGTGA
ATGTGTATGTGACATGCTTAAGTTTTCATTAAAAATATCC
GTCACCTCATTTTCTATTCAATTTGTCATGTTTGATTCAT
TGATGTAAGGATATTAAAGGTTAAGTTTCACTACAGATAC
ATTTAGAAAATGTGCCAGTTGCAAGGTATCAGCAAACATG
TCAAAAGTATGTTGTGAGGGAGGTATCTGCAATAGAACAT
GAATACATTCATACACATGTGCACACAGTGTTGCCAACTA
TTTCCAATGAAAAGTAGCTAAATGTTGCCAGATCACACAC
TGATTTGCATATCAGTGATGTCATCATGTGGTATTTGACA
AGCATAAGCCTGTCATGTCTCTAGATGCACAATAAATAGG
TTCTTGTTAACATATAATTTTGATTTTTAAATATAACACT
GATAACGAACAGTTACATTCTTTTAAACAATCACAGCTTG
CTTTTTTAACCTGTGAAACTAACATTTGTGAAAGTGACAA
CGATTATAGCACTATTTGAATTTATTGCTACCTAAATAAC
CAACAATTATGCATGTAGACAAATATCAGTAAATTAACAG
TTGAAAAACAATCTGAGCTAGCAATTTACTAAATTTGATT
TAGCAATTTAATTTTAATTCGCTTTTTAAAAATTGCTAAA
AGTAAATTGATGTTAAAAATTGCTAAATTTGTTTTGAAAA
AAATATGAAAAACAAAGTAATATGAAAAGTTGCTAAATTG
GCAACACTGCGTGCCCATACACCTGTCCAAATATGATAAC
CGCAAAGGTAAGTGTTTTCTAAAAACGAGTTTGACAGATA
TAGTCACATTGAGGAAAATATTTGGTGGTACTTTCAAATA
AATAGAGTTGCTTCTATTGTATTTAAAACATATCTTTTCA
AAGTACAATATTATTTACATCATAAAGTGCTACAAAAACT
GGAATGGATTGTTCTTGTAAGATTCAGCTTTCAATCTGTA
TATTCACTGGTTCAAACACCAGTTGTGAAACTTTGAAGGA
GAAGGAAGATGGAAAAGACAGAGCAAACCTTCATCCAATG
ATGCTGCAATTGAACGCATTCATGATGTCAGTGCTGATGT
GCCACAAGGTCCTGATGAATCTACAGCTGAAGAGGTGGTC
CAAGCTCCTGTTGTGAAAACTGGAAGGAGAAAGAAAATGG
ATAAATCAGATAGACAACCTTCAGAAGAACTTGAAGAGAA
AACATCCGAAACTGTTTGTGAGCGTAATGATTGTTTCACT
GCATTTTCTGTAAATAAAATTTGATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations