header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-468
Transcript Name: si:dkey-118k5.3-201
Previous Names: dkey-118k5.3-001, si:dkey-118k5.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057367 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057367|OTTDARG00000039991|ZDB-GENE-121214-294 si:dkey-118k5.3|OTTDARP00000044957 DKEY-118K5.3-001 LG_ CR478288.14 Danio rerio protein_coding NOVEL, 4163 bp
CTTGTATTTTGTTATTGCTCAATAAATCAGGTGACTTGCG
GGGGAAAATGACAGAGCATGTCAATCATATGGACGCCTAT
AATGTTGCCGTTATATACTATAGCGATTCATTTATAAACT
GTAATACGGTAGTAGCTTTCGTGTTAAGTAATCGATAGAT
ATCTCCTATTTGTTTTACATCATGTGAATATTTTGAATAC
GGCTATTATCAAAGGAAAGTTTCACTTTCAAAATGAATGA
GATTCTACGGAAGTGAGGGAAGCGTGTGATACTGTTTATT
GGCGTATTTAGCCATTCCTTTGTTTTGGTTTAGGAGCTCT
TATTATACCTGTTTGGATGTACACCGGTTATACAGTAAGC
CAGATTTAATTCAGAGGTATTTAAAGGAATGTGTTGGGTT
ACTTTCTGGGCGTCAAGCTATTCGTTTGATTTCCCTGTCA
GAGTTTGTTCAGTAATGTTAAGTACCGTTTAAATAATACA
TTGTGTTTTATTGATATGACAGTGAACATATTTGGACAAA
CACCTTCTGAGTTAAGAAACAATGACACAACATTCATTAC
TTTTTTGTCGATTTACCACACGATACCGACATAAATGAGA
CACGTTGTGTTGTCGTGCTGTTTTGGTTAAACTCTGACAA
ACACTTGTTTAACAGACATGTATCGTTGTTGAAATGTTAT
TTGAATACGCGGCTGGAATAACATTAATTGTACAAAAAAA
ACTAATTTTAACATAAAATTAATTAATTATTCTTTTTAAA
TAACTTCAAATTAGAATTGAAATCATTTTCAGGGGGTTCA
GGCCATAATAAGGGGGCCCCAAATTCCCCCAGAGCCGGTA
ATATTTTAAAGTGATGGCTGTTAGAGTCTGTTGCACTGAG
ATTCAACTGCGTCGCGTGGAGCTGGTGGAGAACTACAGTA
TACACTTGACACGCCTTCTGGACGTGTTGTTTAATGTGGG
GGCATTGACCGAAGAGGACCTCAGTCTCATAAGGGGCTCG
TCTGTTAGAGGCGAGCGGGACTGTATGAGATTTCTGCTGG
ATGTGCTGAATGGTAGAGGAGAAGAATCATGCAGGGCGTT
TTTCTATATACTACCAAGTATCCAAGATGGGACCTTACAA
ATAGGGCAGATCGGCAGACAAGAGCATCTCAAAAAACACA
AGGAAATCTTATCAAGGGAGCACAGCCTGGTGGACTATCT
CAGCATCAGGAGACACACTTCAGGGCAGGATGAGACCAGA
CAGTTGACTGATATCACCTTCTCAAGACAGGCTGGTTATG
CATCATCTTCTCAATGCCGACATGAATCAACTGGAGTTGG
AGATGCATTCAGAACATGTGCAGATGATATCTGCGTTTTC
AGCGATGTTTACGGCAGTCTGCTGTCCAGTCAATCGAGTG
GTGTGAACATGTTGTCAGGAGTTGCTGGAAGTGGAAAAAC
CACAGTTGTAAGACGCTTGGTGCGAGAGTGGGCTGCAGAA
ACCACTTCACACAAAATTGTCTTACCCTTGTCCTTTCGTG
AGTTAAACCTCATAACTCAAGAGCAGAGCTTGCAAGACCT
GCTCTCAGATCACTACATTCACCTCAAACCTTTCCTGCAT
GACTTACTCAAGTCAAAACCAACCCAGTTTTTACTCATCC
TAGATGGTCTGGATGAGTTCTGCTACCCTCTTAATTTCGA
GCACACTCCCAAATGCTCAGATCCCGAGAGGGTGCTGCCT
ATACAATCCATTGTGGTCAATTTAATCAAGGGAAATCTGC
TTCCAGGCATGTCCGTTTTTCTCACCTCAAGGCCTCATGC
GGTCTCCAAAGTTCCTCCGGTGCTGGTCAGCCAGTATTAC
AGCCTGTTGGGTTTCTCTGTAGATCAGCAGAAGCAGTACT
TTGAGAAGAACTGCAGATCTCCTGAGGCTGCTGCTGCAGT
TTGGGCCTCAGTGTCGTCCCATAAACCCCTTCTCCTCATG
TGCCACATTCCCGCATTCTGTTGGATTGTGTCCACTGCCT
TGCATGACGGTGGCTCCTGCCTTTATCCTGATCCTGTAAA
TGCCAAGTCAGGAGAGCAAGAAGGCCTCGATAAAGATGAC
CTACAGATACCTTCTGAGATGAGCTCCAAACCTGTGACGA
TCACCGAGATTTACTGCTGTTTCGTTAAATCCATCGTGCT
GTTCCATGCCCAAGGGCGAAGCGAGGGCTCCCATCACACC
AGGCTTCAGCATGCTCCTCATGTCCTGGCTGAAATGCAGC
CAGTACTCAAAAGTCTCGGGGCGATGGCCTTCAAAGGCCT
CCTGGAGAGACGATTCATCTTTGAAAGCTCCGATATAAAC
TCTTTTAATCTGGATAGCACCAAACTCTCACAGGTGTTCC
TCTTCGAGATCCTTAAAGAGGATCGAGCGTCCCTCACCTT
AGAAAAGGGCTTTCATTTCCTCCACACCAGCGTGCAGGAG
TTTCTGGCCGCCTTGTACTATGTTCTACAGTCACTCTCAG
GATCAGATGCGTTTTCAGGCCTCAAACCAAGAACAGGCCG
ATATCTTCAGTCTGCGCTTAAACAAATGGGATCAGCTGTC
AACAAACTCAGCAGGCCGCGGCGTCTTTTCTGCAGACGTA
TTAAGAAGGCACTTCGCTGTGGGGAACAACATCAGTCTGG
ACACATGGATCTTTTCTGCAGATTTGTTTGTGGCCTGCTG
GTTCCCAGGACACGTCTGATCCTAAATGGATTTTTTCCTG
ATGGGCCCAAAATGCATCTGCTCCGTTGCGAGCTCTCTCC
AGACTTGACTCCTCCTTTCCTGCTCCATCTGTTACATTCT
CAGCTCCAGAGCTCCACCCTGGGCCCGGAGAGGCAGGTCA
ATGTTTGTCACTGTCTGTACGAGGCCCAGGACCCAGGTCT
GTCACAGCGCCTACAGGGTTGGATGAAAGTTCTTTCACAG
CAGGCCTCAGATCAGTCTGGTTCGGTAAACAGGGACTGGA
GTGAACTGGCTTTCCTCTTACAGCTCAGCCCAGACCTGCA
GGTTTTACATTTGGACGCTCAAGGACTTGATGCTGATGGA
TTAAGCAGACTCCTACCAGTCCTTCCTCTTTTTTCAACAC
TGAGTCTCGGTCAGAATCCTCTTGGTTCAGAGGGAGCTGC
TGTGTTGTCCCTTGTTCTGAGAAGCCCAGACTGTTGTATT
GAGAGGCTATGGGTGGTTGCGACAGGGCTTGGATGCGAAG
GCCTGAGGATCCTTGCAGAAGCTCTGAAGGAAAATCGTAC
CGTGACTGACCTCAGAATGGCCATCAATAAAATTGGAGAT
GCTGGAGCTGGTTATCTTGCAGACCTACTGAGGACAAACC
GCACGCTGACAGATATCAGACTTCGTGACAATCTAGTAAC
AGATAAAGGAGCCGAAATCCTCATGTCTGCACTCAAAGAG
AACACTACCTTAAAGTATCTGTGGCTCTTTGACAACAAGT
TTACCAAAGATGGCGTCAGAAAACTGAAAGAATTTGCAAA
GACCAGACCCAACCTGGACATTAAAGTGTGCATCTGACAC
TCAAACTGAAAACATCTCTCTAAAAGGAACGTTCGTTTCT
GAAATGGTTAAGCAAAATTTCATTCAGAAATACTATGTTG
CTCTGATATGTTATTTTTAACACACTGTTTCTTCCTTGTT
TATGTTCATATGCCTTTTCTGTGACAACTTCTGAATTTCA
TTGAGATTTTCAAACCCTCTCATCTTATTTAATCAAGATC
TCTACATCACTATTAGTAATACAGTGAAGTATGAATACCT
GGTTTTACTGCACTTTCTCACAACATGTCCCATATATGTC
CCATAACTGTAATGTCAACCACTAGTGCTTACACTACGAA
AGCAGTCCAGGCACATGGGTTTTAGGTCAACAGTGGAGCT
CAAAATATTTAGGCTCCATTTAATTCTTTCAGCTTGCACA
GTAAACAGTGCAGGGTTTCACACAATTCTCCATGTTGTCC
CAACACAAATCGATTAAGTTAGCTTAATTGTCCTTACAAA
TTTAAGTTGATTGAACATAAAACAATTAGGTTATCCCAAA
AAGCTCAGCAATATTGTGTTGATTGGAAACAATTGTGTTG
ATTGAATTAACAATAACACATCTTGAAGGGATAGTTCACT
CAAAAATGTACATTTACTCACCCTCAAGTGGTTCCAAACC
TTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-118k5.3-201 Contained in:
[BAC] DKEY-118K5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057367 (1),  Ensembl_Trans:ENSDART00000122159 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)