Transcript

adgre8-201

ID
ZDB-TSCRIPT-121213-377
Name
adgre8-201
Previous Names
  • adgre8-001
  • ch73-268p17.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052638 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052638|OTTDARG00000036943|ZDB-GENE-121214-35 adgre8|OTTDARP00000041377 CH73-268P17.1-001 LG_ FP245449.3 Danio rerio protein_coding NOVEL, 1960 bp
AAGATTTCAGTGTCTTCATCATCATCATCATCATCATCGT
CATCATCATCATCATCATCAGCATCCGCCAGTCCAGCTCA
ACTAGCCTCCAGTGGAAACCGTGTGTTAAAAACTAGCGAG
AAACTCATTTCAACATTGGTGAAGCGGACAGAAACAAGTG
CCACTGTCAGTTTCACTCTTGCAGCTGTAGAGGGACAAGT
CTTCATGGTTGGACCACAGGTGACCTTAGATAAAATCCCT
CAACTTACCACAACAAATTCTTCTGTAGACATCGATCTTA
TTGGCATCGCCAAGAACAGCAATGAAAAATCTGCTGCTGT
GGCTTTCATGAGCTACACCACAATGGAGAATCTACTGAAG
GCCGACTTCTTCAACACAACTAATGACACCATTAAAACCA
TGATGTCCACTGTGATCTCAGCTACTCTTCCCAAAACCAG
CAACACTGCACTCACCAAAGCAGTCAACTTCACCTTCAGA
CACATCAGAGAGTTTGAGCCCAGCGGTTCTCTGTCCTGTG
TGTACTGGAATATCAGCGAGTGGATTGTAGATGGTTGTTC
TGTGTTAAACAGCAACAGCAGCCACACTGTGTGTTCCTGT
GTTCATCTGTCCACATTCGCTCTCATCATGCAGACCAGCA
GCAGTCCACCAGAATCGAGCGATCTGCTGGATCTGCTGAA
TCTGGTGTGTGTGATCGTGGGTCTGGTGTTCTTCAGTTTG
GCTCTGTTGTCCTTTGCTCTTTGTCAGTGGAGTCCTGGAG
TCAATAATGTGGCTCGAATCAACATCTGCATCAGTCTGCT
GTCGGCTCACCTTCTGTTGCTGCTCACACAACAGTTCCTG
AGCCTCATTCGCCCTCAGCAGGTGTTGTGTGTGGTGATAG
CAGGCCTTCTGCACTTCCTCTTCCTCTCCGCCTTTGTGTG
GATGTTCATTGAAGCTGTGCTGCTCTTCATCTGTGTCAAG
AACCTATCAGAGATCAGCTCCAGACAGAGGGAGGTGCTTA
GCAGTGGGTTCCTGTGTGTGATTGGATATTTGGTTGCTCT
GGTTGTGGTGTGTGTGTCTATTGGGCTGGTTCCAGAAGGA
TACGGCAGTGAACAATGCTGGATTAAATATGATAAAGGGT
TTATCTGGAGTTTTCTGGGTCCTGTTTGTGTCATACTAGC
ACTGAACTTGATTCTCTTCATCAGGATCGTCATCATTCTG
AAATCAGCTCTCACAAAACTGAACGCTGAAGTTTCACAGA
CGAAGCAAACCAAGGTTATGGTGTTTAAAACACTGGGTCA
GTTTGTGGTTCTTGGTTGTCCTTGGATTCTGGGTTTCTTC
ACTAATGGCAATGAGATGCTGGAGATCCTCTTCCTGATCT
TGAACTCTCAGCAGGGAACCTTCATCTTCCTGATCTACTG
TGTGCTCAATAATGAGATCAGGCAGCAGTACTGGAAGTGC
TTCACATTTCTGTGCTCTGGACGCAAACAGCGCTGAGCAT
CATGTTCAGGACAATCCAAGTGATTTAAAAACTAGAGACA
GGGTTTTGCATGCTAAATGTCACATGATAAAACAACAGTC
AATACTATTCATGTATAACCTGTCAGCTTTTTTATTTCAT
CTATAAGGATTTAAGATTTCTATGTGGAGGGGAAAAATGT
TTACTGACTTCTGAAGAACCGTAACTCTGTACAAGTTTCT
GTTTGCTAAAAGAGCGAATGAAATAGATTATTTACTGTTA
TTTTATTGTGTTAAGCGCAGGGAAACACTTTAGTTTAAGT
ACCAAAAATCCATTTCCTGCAGTTCTTGACTGTACACAAA
GCAGCATTGTGCTTATGAACATTGCTTTACATGTGATTAT
GCTGAGGCAGGATTAAAGTGTCCTGCCTTTGAAGCTTTTC
TGGAACTGTAGGTTTCCCTCAGGGATATAGTCAAATCTAA
CACACTCCAACCCCAGCACAAATCCAAATATTTGCACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations