Transcript

etaa1-201

ID
ZDB-TSCRIPT-121213-371
Name
etaa1-201
Previous Names
  • etaa1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052524 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052524|OTTDARG00000036871|ZDB-GENE-080204-12 etaa1|OTTDARP00000041282 etaa1-001 LG_ CU929104.21 Danio rerio protein_coding KNOWN, 2429 bp
ATACAAGTCCAGGATCATGATGGCAGCGGAAAACGCAAAT
AATGTTACACCAACTCGGTGACAGATCGCACTGTGGACAT
ATCGAGCAATACTGTAACATGGAGTCCAGAGGCAGTCAGG
AGCAAAATGAAATCGCCAAACTGACGCAGATGAAGTCGAA
AGTAAACAGACTGAAGCGGAGCCCGAAAGCAGCAGCGCCA
CTAAACAAAAACACAGCTGAGTTCAAAACTCCAACACGTC
CAGCAAGAGGTCAGTTCAGAAGACTGATCCCCGATGACTC
CCCCAGCAATGACCCTGACTGCCATCAGGACATTGTATGG
GACACAACATCTCCATCACCCATTCGGCATGGTCGTGGAC
AAAGGAGAGCTGCAAATGTCCGAGCGGTGGATATATCTGA
CATTGCCAATCGGATCGCTCCTAAGAGTGGCAGATTAGAG
GAAGCGGACTCTTCTTTACTGCAGTGGATTGGTGATAGTG
CCATTCCCTGCACACCAGAAGTACAACAAAACAAAGTCAA
GCACACGACCACAAAACAGAGCACCGTAGACGATCTCATG
CGCTTGGCCAAGCAGTTTGACTTCAACATGAGGCAAGACG
AAGCTCAGGAGCACAACTCTCCTCCAGAACCCCCAGCACA
CGCTGACCCATTTTCAACGGCTCACTACACTTCAGCCACT
AGCAGAGCTTCTGAACGACCCAATGACCACAAGCCTGTTA
CCCAAAGTAAACTCAATCAAGAGATGGACGACGATCTTGA
TCTTCTTTTTGACGGACCGACTCAGCAGCTCAGTGGACGC
CTCAGTCAGACATTAATTAATAGAACCCAGAACGTTCCTG
AGAGAGACAATGCAAAATCAGATGCTTCACAAAGACATCC
TTCATTCGCAACCGAAACAAATCAAGATGATTTTGATGAC
GATTGGAGTAGCGATGGTTTATTTGAGGACTCGCTGCTTT
TGGAAATGACGCAAAATCCGGATTTGTTTGCTGCGCCGCA
ATACAGCTCAACACAAAAACAAGCTCACGAGGTTAAAAAT
ACTGTCAGTGTGATGACAAACAAACCATGTGAAGCCAAAA
ATGTGGGACTGCATAAAACAAAAGTCTCACAGAACAACTC
TCAGATACAGATTAATGGAGGGTTGCATAGAATTGGAAAT
CAGGTGGAAAATAGTTGCACAAATCCTAAAATCGGAGATC
AAAATAAGATCAAAATCGTTCCTCAGAGTTGCATTAGTAC
CAATCAGAAGCAGCGGTTTGAGCACAAAGCACAACACGTT
GTTCAGAAGTTATCTGAACTCAATAATGCTTGCCATTTCC
AGAAAAACGAACGCAACGCTATTAAACCTTCTCAATCGAA
ACCATCCAGCATGCATCAAAATCTAATCTCTAAGCAAAGA
GAGGACACTAATACAGGGCTGGATGGCTTTATCGATGAAG
ATCTAGACTCCTTCTTTGCATCCGATGACATCTGGGATGA
CGGAGTGGAGGATGACGATCTGTTTTTTGAGGTGTGTGAT
AACCTTGAGGAAACGTCTGTGACTAAAGCACCACAAAACA
AGTCATTCGCCACCTCGGAAAATGCAGTGTTTGCACATCC
TTATCCACCCAAAAGGCCCGCCGCTAATGTTTTCACGTCT
AGTGCAAACACATGGGTGTCTCAGAAAGCTGCAGGACCGG
GCTGTAATGTGTCCTGTGATGCAGCGAGACCATCTGGCTC
CTCGAGTAATGGAGCGTATAAATTTAAACAGGTGAGAAGC
TCCTCTGTGGTGGGACACGGGACCTGTGCTGCCCTCACAC
AGCGGGGGGGTCAGGAGAGGGGCGTTCTGGCTGTCATCCA
ATCAGAGGCGAGAGATACTGACAATCATCGGTTCAAAAAG
CCTCACGGTGAATTGGTCAGGTCTGCGCCGGTTCTTGCTA
AAGATGTGTGTAACCCTGCAGTCGTGAAGTGCAGCGACGC
AGAGATCGAGAGGAAGAAGCAGCAGGCAATGGAGAGGCGG
AGACTCAAGATGCTGTCCAATCAGAACCTCAGAGCTCCTT
TCTGAGACGCCGTTACCATGGTGATGTACAACAAAACAGC
CCAGCAGATTCTGTGTGAGTCATTGAGTCTACACCAGCAC
AACTGCAACTGTTTTCATTATAAGCAACAAATGTTTCCTG
TTTTCTAGATTATAATGAGAACAAAGTGTCCTGCTTTACG
CTGGTTGTTAGTGGATAATGTGTTGAATATTTGACTGCTT
AGAAAAAAAGAAATGTTGATCAGATGCTTTGCCATTATCA
GAGATCAGAGTCTGTAAATATACATTCATGCTGATATTCT
CCATAGACCACCATTGATCCTCAATAGAAAATCAGGAGTC
GTTGAAGTTGTCAACTCGCTTTTGTTCAAATGGCATGTAA
ATATAATAAATATTTTCTTTCAAATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations