ZFIN ID: ZDB-TSCRIPT-121213-368
Transcript Name: si:dkey-182i3.8-203
Previous Names: dkey-182i3.8-001, si:dkey-182i3.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051031 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051031|OTTDARG00000035814|ZDB-GENE-030131-4134 si:dkey-182i3.8|OTTDARP00000040108 DKEY-182I3.8-001 LG_ CR847931.7 Danio rerio protein_coding NOVEL, 2826 bp
GTTTGTGTAGACGTTTTTTTATGAATTTCATTGAATATTC
AATTTAGAACTTTTATTTTGAAATCTAAAAACCAAAGAGG
AAGTACTTCCTGCTTGGTGAAACTTTCCGGAGGGGTTCAG
CGGTTTGTTTATATTGCACTGAATCTAGCTAAAGCAGCTG
TCAGACATAAGTTGAGCAGCTCATAACTGTGGACACTATG
GGGAGGTACGAGCTTTTTCAGAGTCAAACCTCTCTCATCA
TAACATTACTGACGGACACTGCAAAACACGAGATACAAAA
GGCTTTTACGAACATCTCAAATGAATCCAGTCTCTCTGAC
ATACTAAACGACCCTCAAATTCAAATGCTTAATTCCATCA
TGGACAGGCTCACTAAAGAAGCAGTGCAGAAGATTTGTAG
TCTCTTCAGATACTGTTCATCTGTTGCACCTCTTCCTGCT
CAAATGAGTCTGAGTGATGAAGACGGTTTGAGGAAGACTT
CATCTCAGTCAAGATGTGATTTCAGTGGAACAACATATAT
CCATAACCAGAGAGATATTATGTCTTCCTCTTTGAGTCCT
CAGAAGGATCTTGCAACAACATCTCACCAGCAACTCTCAA
GTATTGAGGAAAGTAATGTAAGCACATGTCTTGTGGTGGA
GGACAGAGCAGAAGAAACCACCCAGACAATATTTATTAGT
GATGCTGCTGAAGACCAGAGCTGGTCTGAAGATCAGGAGG
GAGCATTGCAGACATCAACCAAACAACCCGAGGTTTCACA
CGGGAAGGACTCTTTTGAATGTGAGCAGTGCGGAAAAGCC
TTTCCGAAGATGTTTTCTCTCGTCCAGCACAAACGTGTGC
ACTCAATCGTGAGGCCGCACGGCTGTGAAAAGTGCGGCAA
GAAATTCACACTGCTGAGAGCACTAGAAACTCACCTCCGC
AAACACTCGCAGAAGTTTGAGAAGAAGAAATTCCCCTGTG
CCACCTGCGGAAAGAGCTTCAGAGATCTGGCAGCACACGA
GCTAGTCCATGCGGAAGTCAAACCATTTACCTGTGAAACA
TGTGGACAGGGATTCACCATCAAAAGAAGTTTGTATATGC
ACCAAAGAGTCCACACGGGCGAAAAACCATATAGATGTGA
CACCTGCGGAAAGTGTTTCTCCCTGATCGGCACGTTAAAC
TATCACAAGAGGATTCATTCCAACGAAAGGCCCATAAAAT
GCAGCCATTGCAATAAGAGCTTCAAATACCATAAACTTTT
GAAACACCACCTCCGCGTTCACACAGGCGAAAGACCGCAC
ACGTGCGACATCTGCGGGAAAAGTTTCGCACTTTCTGGTA
CATTAAAGCGCCACATTCTTATTCACACCGGCGACAAGCC
TTACGTCTGCGAGGTTTGCGGCAGAAGATTCAATCAGAGA
AGCACTCTTAAAGGCCACATGCGTGTTCACGGTGAAAAAC
GGTTTATGTGTGAAATGTGTGGCAAAACCTTCCAGTATAA
TTACGTTCTGAGGAACCATATTTTAACACACAATCAAATC
AATCCGGGTGAAAAGAGCAACGCTCAGCGCTGTGAGGTGT
GCGGAAAGTTCCTCAGCTCCGCTTACGCATTGAAAGCTCA
CCTTCAGCTGCATTCGGACAACAGCAAACCGTTTGCCTGC
ACGTCATGTGACAGGAAGTACAGCAGCATTCATTCCCTCC
GAATGCACGAACAGCTTCATACCGGTGAAAAACCGTTCAA
GTGCGAGATCTGCGGTAAGGACTTTTCTCTGAGGGCTTCA
TATAAAACCCACATGTTTCTGCATTCAGGAGAAAGACCTC
ATAAATGCTTGCTGTGCGGTAAGAGATTCAAACTGTCGAG
TTCGCTGAAGATGCACATGCGCACTCATACAGGAGAAAAG
CCTCACAAGTGCGAGACGTGTGGGAAGGCGTTTCATTTAT
CAGCTAATTTGAAACGACACAGGCTTGTGCACACCGGGGA
AAAGCCGTTTACTTGTGACATTTGTCTGAAGAGTTTCACG
CAGCCCAATAATTTGAAGGCGCACATGCACATTCACACCG
GGAAGAAGCCGTACACCTGCACAAAGTGCTGGAAAAGTTT
TGCATATCAGAGAAATTATAAAGAGCACAAATGCGTTCCA
GTTTGAGAGGTTTTACTTGATGCGTTTAAACTGAGCATGT
AGGATTGTAATGACTTTACTGGTGAATTTCTGGATTGTTC
GTGTTTATCGAATGTTATTAAAATTAAAATAGTTTTGCTT
TTTTTTAAATGGGTGAGTGTATGGGTGTTTCCTAGTGCTG
GGTTGCGGCAGGATTTACTGTGTAAAACATATGCAATGCA
TATGTGTGTTTTGGGGTGACATGGTGTCACTGTGTGTAGC
ACTGTCACCTCACGTGGAGAAGGTTGCTGGTTTGAGCCCC
GGCTGGGCGGGTTGGTGTTTCTGTGGGGAGTTTGCATGTT
CTCCCGGTTTTCCCGTTGGTTTCCTCCGGGTGCTCCAGTT
TTCCCCGCAAGTCCAAAAACAAAATGTCTAGGTAAATTGG
GTAGTTAAATTATCCATAGTGTGTGTATGTCCTGGTTCTT
CAGGGGTTGAGTGTTGGGTTAATGACCCACCTTGATATAA
ATGGCCCTGGAATTAAGTATATGTGTGTTTAAATCTCGGA
TCTGAGACTAGAAGGCAATGTGTAGAATAAGTGTACTATA
ATAAACATAATTTAAGAAGCGCTTCACTTAAGGACATGAA
TTATAATGATCTGACTAAACACATAGATTTTTGTTTTTAC
ATCATGAACATTGTGTATTTTTACTCTTTATAATATCTAA
AATAAAAGTACTCAGAAAATATTAGA

si:dkey-182i3.8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-182i3.8-202 (1)    Ensembl 847
si:dkey-182i3.8-203 2826
ncRNA si:dkey-182i3.8-003 (1)    Ensembl 422
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-182i3.8-203 Contained in:
[BAC] DKEY-182I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000051031 (1),  Ensembl_Trans:ENSDART00000152786 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH590059 (1) 959 nt
CITATIONS (2)