header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-294
Transcript Name: kcnh5a-202
Previous Name: kcnh5a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058154 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058154|OTTDARG00000004858|ZDB-GENE-061106-2 kcnh5a|OTTDARP00000045531 kcnh5a-002 LG_none BX890573.6,BX248118.10 Danio rerio protein_coding KNOWN, 787 bp
ATATTATATTGCACTACTGCACCTTTAAGACCACTTGGGA
CTGGGTTATTCTCATCCTCACCTTCTACACAGCCATCATG
GTGCCCTACAATGTGTCTTTTAAGACCAAGCAGAACAACC
TGGTGTGGTTGGTACTGGACAGCGTGGTGGATGTCATCTT
CCTAGTGGATATTGTGTTGAACTTTCATACAACTTTTGTG
GGACCTGGAGGAGAGGTCATATCTGACCCAAAGCTTATAC
GCATGAACTACTTGAAGACCTGGTTTGTCATAGACCTGCT
GTCCTGTCTACCCTATGACATCATCAATGCCTTTGAAAAC
GTGGATGAGGGTCTCAGCAGTCTGTTCAGCTCATTGAAAG
TGGTGCGTTTACTCCGCCTGGGTCGAGTTGCTCGCAAACT
GGACCACTATCTGGAATATGGTGCTGCTGTGTTGGTTTTG
CTGGTGTGTGTCTTTGGCCTGGTGGCACATTGGCTGGCCT
GCATCTGGTACAGCATTGGAGATTACGAGGTCATCGATGA
AGCCACCAATAGCCTCAAGACGGACAGCTGGCTTTATCAG
TTAGCCATTAGCATTGGGACGCCGTACCGCTATAACGCCA
GCGGCTCAGGCCATTGGGAAGGTGGACCAAGCAAACACAC
GCTCTACATTTCATCTCTCTATTTCACCATGACCAGTCTC
ACCACTATTGGCTTTGGCAACATTGCACCAACCACTGACG
GGGAGAAGATCTTCTCTGTGGCCATGATGATGGTGGGCTG
TGAGTATTATTGGTTTACTTTCTTTTA

kcnh5a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kcnh5a-201 (1) 3424
kcnh5a-202 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnh5a-202 Contained in:
OTHER kcnh5a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058154 (1)
  • Ensembl_Trans:ENSDART00000131859 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)