Transcript

ankrd22-201

ID
ZDB-TSCRIPT-121213-279
Name
ankrd22-201
Previous Names
  • ankrd22-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058106 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058106|OTTDARG00000040475|ZDB-GENE-040426-1120 ankrd22|OTTDARP00000045497 ankrd22-001 LG_ FP102417.5 Danio rerio protein_coding KNOWN, 1106 bp
TCGAGTTCGACGGGAAATGAGTCTATCGTCTCTCGTAGCG
GATGAATCCACCGTCCCCTACACACCTGAACTGAACTGAT
TGCGTCATTATAGCTTATGCGTCATCGTTACGCCCTCAAC
CTTATCACCTGAATCACTGGTACCGCTCGCAGCAGGTACA
AAGCAAATTAGCGAAGGGCTGTTAGTTTTATATCTTCAAA
CTTCAGATAAAGGATTTGTAAGTTTCGTTTTGCTTCAGGG
ACAGAGGAAGACAAATGGGGATCTTGTACTCAGAGCCCAT
GTGTCAGGCAGCTTATGATGATGACATCCACAAACTGAAA
GAACTCATCTCAGCTGATCCCAGGAACATAAATGCTCAAG
ATGAAGGAACGGGAGACACACCGATCATAGCTGCCTGTAG
ACGGGGCAACCTCAGGATTGTAAAATACCTGCTAGATAGC
AATGCAAATGTGTCCATAAGGAATAAGAAACAAAGGACTT
GTTTGCACTATGCTACAAGAAGAACCTTTTCCTTCTTGGA
CTACCTGATGATTGCCATTTTAATGCCTATTTTGCTCATT
GGTTTTCTTATATTGGAAGAGAAGCAAAGAAAAAATGTGA
AGTTGATGGAGTTTTTGTTGGCCACTAAAGTGGATGTAAA
TGCTGTAGACTATAAGGGGAACACTGGACTTCACTATGCG
TGCCAAAGAAAAAGTCAAAGGATTATTCCATTGTTACTGC
AGAGGAATGCAGATGTTTCAATACAGAACAAAAATCGGGA
AACTCCACTAGATATTGCACAGAAACACAAATTCCTAAAA
ATTGTTTCAATGTTAACAAAGTCAATGTGAGTATTAATGG
AGCACTGGGGTCCTGCACAATTCACCAGATGAGTTTTAGT
TTTGATGTGCACCAAATATTTTTTTTCTGCGCAACAAATA
TTGTTACATGTGATGTTCTGAAACTACATTTTCTCTGATG
AAAATGCTGTATGTAAACATTTGATTTACTGATTTGTTGA
GACTTTTCAGACATATCGTGGTTTGTTTTAATGTTCAAGT
TTGCTTTTATCACTGTACAGTATAAAATGTATTTCCAAAA
AAAAAAAAAAAAAGCTCACTACTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations