ZFIN ID: ZDB-TSCRIPT-121213-248
Transcript Name: kcnh4b-201
Previous Names: kcnh4-001, kcnh4b-001, dkey-29k16.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058010 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058010|OTTDARG00000040419|ZDB-GENE-121214-54 kcnh4b|OTTDARP00000045428 DKEY-29K16.1-001 LG_none BX571950.6,BX649204.22 Danio rerio protein_coding NOVEL, 7373 bp
ATGCCAGTAATGAAGGGGCTGCTGGCACCCCAGAACACTT
TCCTGGACACTATTGCCACCCGCTTCGATGGCACTCACAG
CAATTTCCTACTTGGGAATGCTCAGGGTCACCGTGGCTAT
CCCATTGTGTACTGTTCTGATGGATTCTGTGAGCTGACAG
GGTTTGGACGAACAGAGGTGATGCAGAAGAATTGCAGCTG
TCATTTTCTTTATGGCTCAGGCACTAGTGAGCAGGTTGTT
CAGGGTGTGAAGAAAGCTATGGAGGGCAAGGAGGAGTATC
AGGCTGAGGTCCAGTTCTACAAGAAGAATGGAAGTTTGTT
CTGGTGTCTGTTGGACATTGTACCCATTAAGAATGAGAAG
GGGGAGATGGTGCTTTTTCTCTTTTCTTTCAAAGACATCA
CAGAAACGCACGAGAAGAGCCATCACAGCAGCAAAACCGA
TGATAAGGCAAACAGCAGGACTACTGAAAAGTCTCATATC
AGTAAAGCTAGAAGGAGGGGTCATGCCATGATTTACCAGC
TAACCAGCCAGTTTACACGTGACAGCAAAAATGACGTCAA
ATTAAGTCGGGACATGTTTGAAAAACCGTCTCTGCCTGAG
TATAAAGTGGCAGCAGTTCAGAAGTCTCGATTCATCCTGC
TGCACTACAGTGTGTCCAAGGCATTGTGGGACTGGATGAT
TCTATTGGCCACTTTCTATGTTGCTGTGACAGTGCCATAC
AACGTGTGTTTCACAGCGTACAGTGATGTGGAGACTGCAG
GCAGGAGCACGATAGTTAGCGACATTGCCGTGGAGATGCT
TTTTATTCTGGACATCATTCTTAACTTTCGCACCACCTAT
GTGAGTCAATCAGGACAAGTGGTGTACGAGCCTCGCTCCA
TCTGTCTGCATTATGCTACCACATGGTTCTTTGTGGATCT
GGTGGCTGCCCTGCCCTTTGACCTGCTCTATGCATTTAAT
ATTACTGTTACATCTCTAGTGCACCTGCTGAAAACTGTGC
GATTGTTGCGTCTGTTGAGACTCCTGCAGAAGTTGGATAG
ATACTCACAGTACAGCGCCATGGTGCTGACGCTGCTTATG
TCCATGTTTGCTCTTCTGGCTCACTGGATGGCCTGCATCT
GGTACATCATTGGGCGAAAAGAGATGGAGACCAATGCAAG
TGGAGCCTGGGACATCGGCTGGCTGCATGAATTGGGCAAG
CGTTTGGACAAGCCCTATATGAACAGTACATTTGGTGGTC
CCTCAGTTCGCAGTGCCTACATTGCCTCTCTGTATTTTAC
CTTGAGCAGTCTGACCAGTGTGGGCTTTGGTAACGTTTGT
GCCAACACTGATGCTGAAAAGATCTTCTCTGTTTGTACTA
TGCTTATTGGAGCTCTCATGCATGCTGTGGTGTTTGGAAA
TGTAACAGCTATTATCCAGCGCATGTACTCACGTCGCTCA
CTATATCATACACGCATGAAAGATCTAAAGGACTTCATTC
GGGTTCACCGGCTGCCACAACAGCTGAAACAACGAATGCT
GGAATATTTCCAAACCACCTGGTCTGTGAATAATGGCATC
GATGTCAATGAGCTCTTGCATGATTTTCCTGATGAGTTGA
GGGCAGATATAGCCATGCACTTAAACAAAGACATCCTGCA
ACTGCCTGTGTTTGAAGCTGCCAGTCGGGGTTGCCTGCGC
TCACTTTCCCTCCACATCAAAACTTCTTTCTGCACCCCGG
GAGAATATCTCATCCGACAAGGCGATGCATTGCAGGCCAA
CTATTTTGTCTGTTCTGGGTCACTGGAGGTTCTAAAGGAC
AACATGGTTTTGGCTATTCTAGGAAGAGGAGATCTGATTG
GATCAGACCTCCCAGGCCAGAATCATGTGATTAAGACAAA
TGCAGATGTGAAGGCACTGACGTATTGTGACCTGCAGTAC
ATTGGTGTGAAAGGTTTAAGCGATGTGCTTGAACTTTATC
CTGAGTATGCCAACATCTTCACTATAGACATCCACCGAAA
CCTCACATATAATCTGAGAGAGGGCAGTGAGACTGAGCAG
AATTACCCAGACTTCAGTGTCTCAACTGAGAATAAGCGTC
CATCCGTTGTAGAAAAGGCTGATGATCCAGACAAGTACTT
CCATGTTTCATCTGCTTCTAGTACATGTAGGAATCTACTC
CTGCCCAATCTAGGCAGCCCTGTGCGGCGAACATCATTAG
GGAACCTTTTAGGAGAGGAGTTAATGCAATTCAATGCCCT
ACGACATTGTCGCTCACCCGTCAGGGGCTGGAGTCCAAAT
CCCTCTCCAAAACCTCCAAGCAAAGTACAGAAACAAACCC
AGCAACCTTCATCTACGCCTAAACCCATCCATAAAACACA
AACAGATTCTGGAAGTATGGCGCGCAAACCTGCCAAGCTG
CTCATCCCTACTCTCAACTGCTTTGGACCACCAGATCTTA
GTCCAAGAGTTGTAGATGGAATTGAAGACAATGGGCACGT
ATTTCAATTCAATGTTGAAGACACCTCTACCAAAGGTACT
ACAGAGACATCACAGAGTAGTAAGACACTGGATGGCTCTG
GTCAGGTGAATGTTTCCCTGCTACAGGAAACAAAGGAAGT
GAGAGAAACTATTGATCAGCTTAACAAGAAGATGGGCAAC
CTGAAAGAGGAAGTGGCTAATCTAACAAAAGATCTTCATC
ATATAATGCACCTGCTTCAAGCACATATAGCTGCTCGTCA
TTATGCTGCACCTTTCTCCTCCTGTCCCTATGGAGTCCAC
ATGATGTCCAGTGCTGCTGTCAGCATGTCTCCAACCTACA
TTTTGGGTTCCAATATCCACATGCAGCACAAAGACCATGT
TGTCTCTGAGGGTCTTTTGAGATCCACATCATGGAACCAT
AGCAGAGTTAATGGTGGGTCTGGTTTTGCTCAGCACACAG
AGAAACAGGGACACTTTCACCAGCATGAGCCTATTCAACA
CTCTACAGTTCCAGCAAATGACCCCTGTTCCCATGACTGG
AGTTCCATTCTTACTTCATCCTCGTCCAGTATCAGTCATC
ATCACTTTTCTACTGGTCCAGGAACCCAAGGACCAACACC
AAGAGAGGCTCCACAACCAGAGGGTTTATTATTAAGTGTT
TGTCCTGGAGATGGAGCCCATGCCAGTATCAGCCAATCAC
AACCTGTTTTGCAGAACTTGTTTTCTCAAAACTTGTGTGG
TTCCGGTTTATCCTGTAAGGTCACACCTAGCTCGTATTCA
CATTTACAAATTTCCACAGAACCAGCTCCTTCCTACTCCA
CTCTAACCTTGGGTGAAGTGCACAGGACGTCAGAAGTGGG
CCTTGCTCACAACCAGAATTTGGTATCTTCCATTTTCCCA
CAAGAGCATTCTCCGCCCTCTCCAAAGGAATTGGGCATAA
TTCCCTGTTCACTTGTAGAATCATCTGAGGTAGAGCACAC
AAGTCAAGAGTGCCTGCTAAGTAACCAAAGGCTGGGTCAA
GACAGTGAAACGTCAGAGAGCAGGTCTAGCGAGTCCAGTG
TAGGACTTTGTAGCCAATCTGAGAGCTCAGAGACCACTTG
GTGCCTGGATCTAATAGACTGACACGATGGAAGACTACAA
TCAACAATCACAACACAATGACACATTTATCTTTTATTAT
GGATTTCATAACTTTGTTTATTTAGGATTAAATGGAAAGC
ACTTGCTCAGTGGTTTATCGTGTGGACAATCACAAAGCCC
CCATTTCACTAATAGGGTGTCTTTGCTGGTGCCTGATCCC
TTGCCATTCCACTACAGAAAAGGGCAGTTGATGAGTGTGG
AGGAAATGTAATCTTTTCATTAATATATAAATAAACAGGA
AGAAGTCGGCTAAGCAGAAAATCATTTAGACTGCTACAAA
GTAAGATTTCTAACAGTAGGGTCTCTTTGCTGAAGCCAAA
GGCAGTGCCCAGACTTTCCCATTACTTTCTAGAAAAAAGG
AAGCTCCAAAACCAGAACCTGGAATCCTTTTCCATTCCAC
TGGAGGAAATGGAAGCTCCGTTGTTGGACAAAATTGTGCC
AGAACAGCTTCAAGAACCTGCTAGTCACAAATAAGAAGCC
ACAGAATGTCGGAGGCTGGGCCCTGATGTCCTTACCAAAA
ACACGGTTCCTGGTATTCCACACCAATCACAGAAGCTGTA
CAACTATGCAAAGAGGCATGTGAAATGGAGAGCATCTCTG
TTAAAAAATTGTGACTGTTTGTTGTCAGTACAGTAAACGT
TTTAGTTGTTTACTGTGGACATCCAAAGACATTATACAAA
TCACTTTTATTATTTTCTTAATTTAACTATGGTTTAAATT
GTTTATTCCTTTAAAGAAATAGTTCATCCAAAAATGAATA
TTGACTCATCATTTTCTGTCTTTCATGTCTTCTGTTGAAC
TTGATATTTTAAAGCAGGGGTCACCAATCTCGGTCCTAGA
GGGCCGGTGTACCTGCAGGGTTTAGCTCCAACTTGCCTCA
ACACACCAGACTGGTTGTTTCAAGTATACCTAGTAAGACC
TTAATTAGCTTGTTCAGGTGTGTTTAATTAGAGTTGGAGC
TAAAATCTGCAGGACACCGGCCCTCCAGGAACAAGTGTAG
TGACCTTTATTTTAAAGAATGTGTTACTCATTGACGTCCA
TACTAGGAAAGAAATCATTAAGGAAGTCAATGGGTCCCAA
CAATTAGCCTTTTTTGTAACAAGTTAAAGATGCATGAATG
ATGACATTTTTGGGTGAACTATTCCTTTAAAAACATTCTT
AAATGTTTAAATAAATGTAGACTGTAGATAGTAAAATAGT
TGCACTTATGGAATAAAAAATTAGTTTGATTTGTAATTTA
CTGCCAGCATCTCACTGTTCTGACATGCTGTATACAATAA
TTTATGCCTATTTTATTACTTACATTACTAAGAAAATGAT
TCTTATTTAAGTTTTGCCAATTAGATCAGTGTTTCTCAAC
CACGTTCCTGGAGAACCACCTACACTGCATGTTTTGGATG
TCTCCTTTGTCTTTAACACCCATGAAGCTGCGATCACACT
GCATTTTTCTTCCCGTGCACTTCCATTCATACGCACACGA
ATGTGTCAGACAGAAAACAGGTAGTGCGGCAAGTTTTGCA
GTTCGCTGCATTGGAAAATTCAAGCTTGGTGAACTCTGAC
CTGCAAAATCGCGTCATATTATTGCATGAGACCAATCAAG
GATATAAAACATGACCTCTCGTGACAGAAGTTTAAAACAT
GGACATATCACTTGCTTTTTTTAACGTCTAATCATCTTAA
TGTCATACTGAACTTATATAAAGACATGTTTGGACATTAA
CATCTGAATGCATAATTATCCAAAGACCTGTGGAGATATC
TTTGCATTAAAGAATGGGAGATTATTCTGCTGCTGCCCCT
CTAATAAGGTAGAAAATTAAATATGACAGATATGTGGATA
ATTAACAGGGCTCATAGCCAAGCAACACAAAGATCTGTTA
ACAAGGAAGTACTATATCCCAAAGCTTGCCTACAATTCTG
TTATACACTCAAAATTACGTATTTTTAATTCACAAACAAG
TACATACTTTTAGGGTGTATTATAAGTATGCAAATTGGGA
CGCAGCAATGAATGGGAGTGAAGCGATGCAACTGATGCGG
ATAGGTCACCTCATCATGACAAACTACTTACATTCATACT
GTATAGAATGTAACGTTACTTTTCTAATGATCGAGTAATA
AATTTAAATTCAAATGCAGTACCTAATAGCCCCTTTCACA
TATACAGACCTTTCCCGAAAATTACCTGCAATTTTCCGCA
AAGGTCTGTATGGGTGACATTTTTTAAAATACCGGTAAAT
TCGTTCCGACAATTTTTCCAAAAAAAGAAGTTGTAACATT
AACGGTAATTTGCCCGAATGCTGCTCTGTGTGAACACAGA
AGGAAGATTGCCGGAAAGAGCGCATTCATGGCTAGAACGT
GCTAACGTGAGACATCTACTCCAGCCAACCAGAACATTCA
GACGCATTCACATCCGGCCTTTTTATGAAAATAAAACCCT
TTGAATATTTTTATAGACACATTCAGCTACTAGATATTAG
TCAAATAACTTTTCTATGTTCCTTTCCTAATGGCAACTGT
GGAAAACATTATTAATAAAATGCTTATGGTAAACCATTAT
TTGTTTACCTTCGAGCTCTCCTTCTGTTGCTTGACGCATA
TGCACTTGAAGCAGCCAGTGATTGCCAGCTCAACTCCTAA
GCTAAAACCCTTATATGTTTACTAATACAAGTGCAGTCGT
TAAGTGGTCATTTCTGGTTAATGATGTCAGAATTTACCAG
TATTTTGGAATGGATTTGTGAATGCTCTTTTCTGGAAAAA
TTCCGGAACGTTCTTGCCTGTGTGAACAGCGCTTTTTTGA
ATCTACCGGTAATGTGGTTTTGGTAATTTTAATCACTGTG
TTAAAGGGGCTACTGAGTAGTAAGTGATTTTAGACGCAGC
CATGAAAATGTGCAGAGTTGGTGGTTTTTAGGTATGTGGT
TGAGAAACACTGAACATGACCTCATCACTATGTTTTATTT
AAACATGTAGTACTGGAAAAATTGTTACCATAAAAAAATG
AAATTCCAGAATGTTTCTACAAAAGTAATATTCTCTGTTC
AATTGAGAACAGACATAATTAAAGGCACTTTAAATCATAT
TTACACATAACACAAAAACACTGCATGCAGGATCAATTAA
CAAAGATTATGCATTTTTTATTTTACTGTGTACTGCTGTT
GATGCTGAATCTGGGAATGCTGCATGTTATTGGAATTATT
AATGCTTCAAGTTCAAATCGCTGCTGTCACAATTCTAGTT
ATATTTTATTGCACCAAGTATCTGAATTTAATACTTGGAT
TAAACAGACTCAGGGCTGATTTTCATTTGCACAATGTGTG
ATTTAAATCAACGATAAGGTGATATTATAATTTAATTGAT
TGTATATTATGCAGGACGTATGAATTAATATAGACTTTAA
TGTGATTGTAGTTTATGAAATATTAAAAGCTTTATTTGCT
TGATTGTGTAAAGCTCATTTGTTATCATGAAAGTAGCATT
GCGGTAGCAGACTGGACAAACCTGTTTTCACACACTACGT
GTATATAGTGTTCTTTTTACAAAATAAAACTAAGAAACTG
AATATTAAATACAGTAGATTTTAATTATTTTAAGAGGATT
GTTTACGGTTTTGTTGTTTAGCAATCAAGGGATGATTTGT
AAAATGTAACCAATTGACCTTTCTGCATCTTCCTGTTTAA
TTTTCTCATTTTGCATGATAACTGCAATCATTCAAATTAC
TGCTTCTGTGCATGCAATTCAATAAAGATTCCAATAAAAT
ACTTCTTCCTTGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnh4b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058010 (1),  Ensembl_Trans:ENSDART00000089042 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)