Transcript

epdl1-201

ID
ZDB-TSCRIPT-121213-229
Name
epdl1-201
Previous Names
  • epdl1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057906 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057906|OTTDARG00000040354|ZDB-GENE-090710-3 epdl1|OTTDARP00000045351 epdl1-001 LG_ CR926130.14 Danio rerio protein_coding KNOWN, 2050 bp
CTCAAGAGCTGTGTATGAGGAAGTGTGTGTGTGTGTGTTT
ACTGTCAGACAGCAGCTTAACTCTCCACATTGTGTGTGTG
TGTGATGATGAAGCTGCTGCTGCTGTTTGTTGCTCCGCTG
CTCTTTCTGACCGTCTGCTGTTCTGCGCAGAGACCACACC
AATGCCACAGTCCACCGCTGCTGTCCGGCAGTCTGAGTGT
GAGCGCTCGAGATGGTCAGGACTGGGCGGTTGCCAAATAT
CGCTATGATGCGTTCGGGCAGCGGATCCGACTGTGGGAGT
TTGGTGAAGTGGACAGTAAATCCTTCCACCTGAACATGCT
GTTCCTGTTTCGAGAGGGTGTTGTTTACAGCATGAACTAC
AAGAATGAGACGTGTCAGAAGAATGCCCTGCACAGCTCCT
TCCACCCCTCACGGATCCCCCGTAATGCAACACTCCTGGC
GCAGGTGATTCTGGGCGGCTCGTCGGCTCCAGGTGAAGGT
CTGCTGGTCAACACCTGGACAGGAGACGTACCTGAGACTC
AAGGTAAATATGTGGCCACAGTGACTGAGTTCGGCTGTAT
CCCGGTGTCCACACTCTACTACACAGAACAGACCGGCTGG
GTCACCACCACCTATTTTAACGCAGTGACGGGAATCCCGG
ACCCGGAGCAGTTCATTCCTCCCCCATTCTGCAATGAAAC
AGAAACTGAAGAGGACACGCTGGATTTCTTCAGCGCCTTT
TTCTGATCACTCTGTGCTGCACGTTTAATATGATCTACAC
AGCGGTCAACTGATGAAGGCTTCTGGCAAACGCAGTCATT
TTAACCCTCCAGCTTCCCCAAGGATATCTGTGGCCATTTA
GAGCCACTTTATTTAGGCTTGTCCATAATCTGAGCAGTTT
ATTATATATTAGTAACACTTTACAATAAGGTGGTATAAGT
TAATCTATTTGGTAACATGAACAAACAATGAACACATTTA
ATCCAGTGCTAGCTCATGTTAGTAAATGTAAATACAGCTG
CTGATTGTTAGTTCATGTTAACTCACAGTGCATCTGCTAA
GTTATTAATTTCATCAGTGAATGTTGATCTATGATTGTTA
AATGCTGTACAAGCACTGTTATGAACCCTGATTGTAAAGT
GTGACCTGTATATTGACATTTACAAGTTTATTATTTGAGC
ACACACAGACAAAGAGGGTTAAAGTGGTTGAAAGATCATT
TTCTTTTCTGTTTTGTTTAAATAGTTTCTTTTAAATCAGT
AATTTAAGGACTTGGCTATGTTTTATAAGTCTGCTATTTG
AGCAAACACAAAAAAAACATGAGTTGTTTCAGCAAATCTA
ACTGTAAAGAGGACTTTATCATAACATCATTTTTCCTATA
GGAAATGAATAGAGAACAGTCAAAATAAAAGCATTTGTTT
AAAAATCTGTACTTTTAGAGGCATATTAATCACAAAAAAA
AAACAATGCCAAAATAAAATCTCTAATTACGTAATTTGGA
AGTTTGACCAATACATTTATATGACCTTATTTAGAAAATA
AATGCATGAAAATTGGGTTCACACTTGAGATATTGAAGCC
CGAAAGTGTCCAGAAGGTGGCTTTAGGGTTAAATAACTGT
TTACATTTGCTCTTTATGATTCAATCTCCTAATAATGACA
ATCAAATGCGCTGTAAATCATTAACGAAAGGGAATTATAC
TTTAACGAATGCTGTGATTTCAGGTTCATTTATGTTTTGT
AGATTTCTGACAATGAAGTAAAACTGTGTTGATGTTCTAC
ACCTTCTCCTCATCTTTATAGTGTAAATGTGGGATTAAAG
ATCCTCTATTATAGTGATTCATCTCTAGATAGAGTTTCTA
ATGAATGAAGGATTTAAACAGCTGTCAATTAATCAATGCT
TTCTGCAAATCAAAGCCATTTTAAATAATGCTTTACGTTT
GTTTTGATGATTTAATCTCTGAATCACAGAAATAAATGCA
CTTTAAATCAAAGGGAATTATACGTTTAAAAATCTGCAAT
TTCTTATTCAAGTTTTATAGATTTCTGTCAATAAACAACA
ACAAAAAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations