Transcript

pgap3-202

ID
ZDB-TSCRIPT-121213-203
Name
pgap3-202
Previous Names
  • pgap3-001
  • dkey-25p11.5-001
  • zgc:171485-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057701 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057701|OTTDARG00000040204|ZDB-GENE-080204-27 pgap3|OTTDARP00000045206 DKEY-25P11.5-001 LG_ CR457459.9 Danio rerio protein_coding KNOWN, 1522 bp
ATAAAGGCAGCAGTCAGAGCGGCGGCGAGTAGCTACTGTC
ATGCTCGGTCTACAGGACTCTCGTTAGACTCACTGTAATG
GCCTGATGTTGCGCTGTTGTGCCTTGTGAGCGGCCGGACT
GACAGCAGCATGACCCGCCTGATGTTTCTCGCGGCCGCGG
CGTTCCTCTTGTCCGCTCCGGCCAGCGCCTCTCAGGGGGA
CAAAGAGCCGGTCTACCGGGACTGCGTCAAACACTGCGTC
CGGACGAACTGCACAGGGGCCCGGCTGCGCGGTTTCCAGT
CCACTCAGCCTCCATACATGGCACTCACAGGCTGGACGTG
TCGTGATGACTGCAGATATCAGTGCATGTGGACCACCGTG
GGCCTTTACCAGGCTGAAGGCTACAGCATACCACAGTTTC
ATGGGAAGTGGCCGTTTGCCCGTTTCCTATGTTTTGAAGA
ACCTGCATCGGCACTAGCATCTCTGCTAAATGGCTTAGCA
TGTCTGCTAATGCTGCTGAGGTACCGCAGCGCAGTCCCTC
GCCAGAGCCCCATGTACCACACCATCACCGCCTTCTCACT
GGTTTCCCTGAATGCATGGTTCTGGTCTACTGTATTCCAC
ACAAGAGACACCTATCTAACAGAGAAGATGGACTACTTCT
GTGCGTCAGCTGTCATTCTCTACTCCATCTACTTGTGCTG
TGTCAGGACGTTGGGCTTGCGCAGACCGGCAATTTCCAGC
ATGGTGGGAGTTCTGCTCATTCTGGCCTTCACATCTCATG
TGTCTTATCTGACCTTTGTCAGTTTTGACTATGGGTACAA
CATGGCTGCCAACGCCTCTATAGGCATAATAAACCTGCTC
TGGTGGCTGTGCTGGTGTTGGCTGAACCGGAGGATCTTGC
CATACTGGTGGAAGTGTGGGATGGTGGTGCTCTTACTGCA
TGGTCTTGCTCTGCTGGAGCTGCTGGATTTCCCTCCACTC
TTCTGGGTTCTAGATGCTCATGCTGTCTGGCATCTCAGCA
CTGTGCCCGTCCACTTCCTCTTCTACAGTTTTCTGATAGA
CGACAGCCTTCACCTCCTGAACACAGAGAAGCCTGGAGTG
AAACTGGACTAGGAGGAATCAGTCTCAGAACCACAACCCC
TCCTATGAAATCCTTCCCATCAGGGCAAGTGCAAGCCGGA
CTGAGCCAGGCCTCATGGCAGTGGTTTTTCCGGCACATGT
CCTGGGGTTCCAATTTCACCATTTTCTTGTGTTTACATTT
AGTTTTTACCATATTTTAAAACCATATTTTATCATTTTAT
TTTATTTTTGCGTTGTACTGGTCGTCGTTTGGTCCGGTTT
TAAAGATGTGCCACTTTACAATAGTCGAAACCTGATTGAT
ATTTGCATTCACTGAGCTTTGCCTTCGATTGAGAAGAAAA
TTAGCCTTTCTTAACCACTTTATCAACATGGCACACTTTT
AAAGAGGTGCACCGTCATTGCTAACAATTACCTTTGCATA
TCTCCAATTCATATCCGTCTACATTTGTGCTGTGTGACTT
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations