Transcript

si:dkey-182i3.11-201

ID
ZDB-TSCRIPT-121213-163
Name
si:dkey-182i3.11-201
Previous Names
  • dkey-182i3.11-001
  • si:dkey-182i3.11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057379 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057379|OTTDARG00000040001|ZDB-GENE-121214-258 si:dkey-182i3.11|OTTDARP00000044969 DKEY-182I3.11-001 LG_ CR847931.7 Danio rerio protein_coding PUTATIVE, 2022 bp
ATGTTTTGGCCTTTGTTGATAATTCTGGATCTCATCGCAG
CAGTTGATGCCTGTCCGATATCCTGCTCGTGTGTTGATGT
TGACATTGTAACATGTTGGAACACAAATCTCCTTGAGTTC
CCTCCTCTGCCTAATGGTACCAAGCATTTTTATGCTACAC
GTAATAAGATTCAGGCTCTCCCAAATGAAACTTTCCATGA
ATTGAGGGTTCTCGATCTCACCAAAAATGTCTTCAATTTG
TCACTGAATACCAACTGGCAGAGCGTGAGAGGTCTTACGC
ATCTACACCTGGGAGGAAATAGACTGAGAGCACTGACACC
AAGACAATTTGAGGGGCTGCTAAACCTCCAAGTGTTGGAT
CTCAGTAACAATGCCATTAAAAGCCTGCCTCAGATGTTTC
TCTATGGCCTGATTAATCTTCAAACCCTTAATCTGAATAT
AAACCAGATATTAAGTTTATCCTATGGGGTCCTGGAGGGA
CCTCTTGCCCTTACAGACCTGCAATTGAGAGATAACATGA
TCGATATGATCGAGATGAATGTGTTTGAGAACTGCACCTA
TCTAGCTAAACTCTATCTGTCAAAGAACAAGCTAAAAAGT
GTTGGCAATGGGAGTTTTAAAGGTGCCACTGGGCTAAATC
ATCTCGATCTTGGTCTAAATGGACTAGCTGGCATCCCTAC
CATTGTCCTTCAAGAGACCTCAAACCTCACCAGCCTCTAC
CTTCAAAAAAATGACATAACTTCAATTCCTGACAACGTTT
TTTCAGAGATTCTCTCACTGAAACATTTGGATTTAAGTTA
TAATGGTCTTGTTTCCATTTCCAATGGTTCCTTTAGAAGT
CTTTCTCAGCTGGTTTATTTGGATCTTAGTTTCAATCAGT
TGCAGACACTAACGCAGCATGTGTTCGAAGACTTGGGGAA
GCTTGAAAACCTTAATTTGTATCATAACAAACTGACATCG
CTTCCAAACAACATGTTCAAAAACCTGACTATGTTAAAAG
AGCTCCAGCTGGACAGCAATAATATTTCTGTGATCCCACC
AGACCTCTTTCATCCCCTATCAGCACTGAAGGATCTACAA
TTAGACAACAATCACATTTCGAAGCTTCACTCTCACACAT
TTAAGAAACTGAGGCAGCTTAAGCAACTGGATATTAGCAG
CAACGACCTCACGAAGATTCCAAATCACCTCTTTCATAAG
AATCTGAAGGAGCTCAATCTGGAGAACAATCATATCAGCT
TCATTTCAAAGTTCTCCTTTAAAAATCTGCACCGACTACA
GTCCCTGAAACTCAGCCATAACAACTTGTCAAAACTTTAT
AGAGAGTTACTCACTAATCTTACAAGGTTGCGGGAGCTAT
TGCTGAACGAAAACCAGATAGAAACCATACCTGTTGGATT
TTTTAAAGGTCTTGAAAACCTTAGGGTTCTAGACTTGTCC
AACAATAAGATGCATTTCATCTTACCAGATGCCTTCAATG
ATCTGTCTGCACTGAAAGACCTAGATCTGAGTTTCAATTT
TCTCCATAACCTTCCAGAAGACATCTTTGCATCTTTAAGA
AACCTCACAAAGCTCCACCTGCAAAACAACAAGCTTAGAT
ATTTGCCCAGCAGATTGTTTTCTGCCCTTGTTGGTTTGGA
AGAGCTCCATTTGGACAGAAACTATATCCAGAGAATTCAT
CCAACACAGTTTGAAGGCTTAGTAAAACTACATGAACTAG
ATATGAAATCAAATCAACTGCGCTCAATGGAAGATGGAAC
TCTAATGCCTTTGAGAAAGCTCAAACGTATTCATCTTGAT
GGGAATCCATGGGACTGCTCCACTGTCGTCATTCTGTATA
TCAGTCAGTGGTTTAACAATAATACTCAGCTGGTAAAAAC
TACACCCATGTGCTCCTCTGGCCAAAATCTTTCCAATCCG
GCTCTGTTCCCTTCATCATTATTAAACTCTGCCTGTTTCT
CTGCAAACATCAAGCAACTTACGGTTCTGTTTGTTCTCAT
TCTAGGCTTTTTATTCTCATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations