ZFIN ID: ZDB-TSCRIPT-121213-162
Transcript Name: si:dkey-182i3.9-201
Previous Names: dkey-182i3.9-001, si:dkey-182i3.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057376|OTTDARG00000039999|ZDB-GENE-121214-310 si:dkey-182i3.9|OTTDARP00000044967 DKEY-182I3.9-001 LG_ CR847931.7 Danio rerio protein_coding PUTATIVE, 3050 bp
ACATGAACGCATTGACCGCGGTATCGTTTGTGTACCCGCT
GAATTCACTCACTTTATATGTAGTACAATGGTGGAGTATG
ACTTATTTCACCAACAAATAGTGTCTATAATGGCACTGCT
GTCAGAAACTGCTCGAGAAGAAATTCAAAAAGTTTTTGAC
TATGAATGTCATCTTTCCCACACTCATATATGTTGTGACA
GAGACGAGTTTTTGGAATTGAATGAGAAACAACGCAGAGT
GGCAAAGCTCACCGCGGTGATGGAGACCTTTTCCAAGGTG
GCTATTCAAAAAATATGTAAAGTTTTCAGTTGTTGCTTGG
CACTTCAGCAGACTCTACTGAGAGATGTAAAAAGTTACAG
TGGAAATGTTGTAAAAGTTAAAGCACTCAAGAAGAAGCAT
TTGGAAAAAGCAGAAAGAAATTGTAATCAAATTGTCAAAG
ATGTACCTGCTGTAGCTCCATCATTGTTTCCAACACAGCA
AAATTTGCTCACTTTGTTACCTGAAGAAAATAAACAACCA
CAAGAATCTGTTGAAGGCCATCAGTCTGAAGAGAAGACTC
ACATTTCTGAATTTTTTCCTGATTCGTCAAGTGCTGCTAA
AGAAAAAACAATGCAAGCATTTCTAATAGAAGTTGAATAC
TCTGCTGTTACATCTGGAGAAGACCAGCAAACTGAAGTAA
ACACACAAGCAGAGCAAATCACCACAAAGTCCAAGACAAC
TAAAGAGCCAGTATCATTTGACTGTAATGACTGCGGAAAG
ACATTTCGCTGGAGACACTCACTAAAGCATCACAAATGTG
GACTTTCAAAAGGACCTCACATATGTGAACGGTGCGGAAA
GAAGTTTAAATTTGTAACAGGATTACAGAAACACCTACAA
AATCACAAAGAGAAGAAGGGAACCTGTAAAACTTGTGGGA
AAAGCTTTGCAGATCTTAAAATGCATGAACGTGTCCACCT
GGAGGTGAAGCCTTTTCTTTGTTCCATATGTGGACGCGGC
TTTACTGTAAAGGGGACTTTAATGGAGCACCAGCGGATTC
ATACTGGTGAAAAACCATACAGCTGTGAGACTTGCGGGAA
GCAGTTTGCACAAACACAAAACCTCACCAACCATCTGTTG
GTTCATAAGACAGAAAAACCATGGAAGTGCAGCCTCTGTG
ACAAGACTTTTAAATCAAAACATAATATGAAGTTGCACCA
GATTGTGCATACAGGAGAGAAGTCCCATATTTGTCATATT
TGCGGACAGAAGTTTGGACACGGTACAAATCTCAAAAGGC
ATCTGCTTTTGCACAGTGGTGTGAAACGGTACGGCTGTGA
AATTTGTTCCAAGCGGTTTTATCAGAGTATAGCTTTAAAG
AGACACATGGCAATACATGGAGCTCCGAAGCCATTCATGT
GTGACATATGTGGGAAGAGCTTCGTGTTTAACTTTGCTTT
ACAGAAGCATTTACTCACACACAGAAATAAAACAAATGGT
AAATCTGGAACTGGGAAGACTTTTCCATGTGATATGTGCG
AGAAAAGCTACAGTACCAACGCTCTGCTCAAAATGCATCA
GAGACTCCATTCGGAAAAGGATCCTTATATGTGTAAAGTC
TGTGGTAAAAGCTACGTCAGCGTGTATTCATTAAGAATAC
ATGAGAGATTACATTTGGGGGTGTCAATGTGGAAATGTGA
CGTGTGCAGTAAGAGTTTTTGTAACAAATATGGGTTGAAA
CTCCACCAGGTTGTTCATACTAAAGAGAAACCCTATGAAT
GTTCTGTTTGCGGCAAAACATATGGACAGCCGCACAGTCT
TAAAACGCATATCCGCATACACTCTGGTGAAAAGCCACAT
AAGTGCAAAACGTGCGGAATGAGCTTTCGGTTGCCTGGAA
ATTTAAGCCGTCACAAGCGGATCCACACTGGCGAAAGGCC
GTTCAGCTGCGAGGTCTGTGGGAAACGGTTTGTACAACAC
AACCATGTGAAGGCACATATGCAAATCCACACTGGTGTGA
AACCATTCACGTGCCAAAAATGCGGGAAGAAATATGCATA
CCGTAGAAATTATAATGATCACAAATGTGTGCCTCTGTGA
AAAAAAGATGTTTCCCTAAGGCAGGGGTGCTCAGCCCTGC
TCCTGGAGATCTACCTTCTTGCAGAGTTCAGCTCCAACTC
TGATCAATAACACCTGAACAGTACTTGATAATCACAGACA
GGGGTGTTTGATATGGGTTGCAACTGAAATCTGCAGGAAG
GTAGATCTCCAGGAGCAGGGTTGGTCACCCCAACCACAAC
GGGTGCTGGGAACTGAAATGCAGTGCCATTTCTGTTACCT
TTGTGAGTTGTTGTTGTTGTTGTTTTTACCTAACCTCCAC
CAGAATGTGGTGGAGTGGTAAGTTGAAATGAAATGAATAC
TGAATTGAAGCTGACTACACCACCCTGATCACACTGAATT
AACACAGGTTCTTGGTGTAAGGAACAGGCATGAGACGTGA
ATAACATTATTTTCCTTAAGTATGCAAAATAAGAATCTCT
GTAAAATGATTAAATATGCAAATATGCACAGAGTGCGAAA
AGAAGAAATTCCTCTGTTGTACAGTACGTGTGGCGAGAGC
TTCAGCACATGAACAGATTCATGCAGAAGTCAAGTCCTAA
TGCAATGTCCTCATTCTCATTCATTGGTGAAAATCTCTTT
TTATATTGCAGCATTTCTTGCTGGAATTTCTTACTATTAA
AAAGAAAGAAAGGCATTCAAAATAAAACATTGGGCAAGAT
GTTGTACATTTTATTACTGTATATTCAGAAGACTTTAAAT
TAAAACTAACATTGGTTTTATTATGGAGAAAGTGTAGTAA
GCTTGTTTTTTTTGGCATATTGATTACCATTTGTTTTACC
ACGGTTTTACTATAAATGTCAGATGGATGGATGGATGTTA
TTAAAAAAACATGGGAAGTAATAATTTTTTACATGTTGGC
ATGGTGACAGAAAACCTGGTAATATTACTAAATTGTGTAT
TGCGAGAGCTTGTGAATTGCAGTTCTCTTCGCCTAACCCT
GCTGAAAATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-182i3.9-201 Contained in:
[BAC] DKEY-182I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057376 (1),  Ensembl_Trans:ENSDART00000152517 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI984000 (1) 557 nt
GenBank:CK687227 (1) 351 nt
CITATIONS (2)