Transcript

napga-201

ID
ZDB-TSCRIPT-120702-192
Name
napga-201
Previous Names
  • napga-001
  • napgl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055963 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055963|OTTDARG00000039031|ZDB-GENE-050320-46 napga|OTTDARP00000047620 napgl-001 LG_none FP245525.4,BX005461.9 Danio rerio protein_coding KNOWN, 2526 bp
ACAATCATCATCGTCAGCTGACAACACATCCAGCGTGCGA
GCGACAAACGAAGGTTTATTTACAGTATTTAATCATTTAT
GTGTAACGATTATGGCGCAGAAAATCAGCGAAGCTCACGA
GCACATCGCCAAGGCGGAGAAATACTTAAAGACGAGCTTT
ATGAAGTGGAAGCCTGATTATGACAGCGCTGCGTCTGAAT
ACGCTAAAGCAGCGGTCGCCTTTAAAAATGCTAAACAGCT
GGAACAGGCCAAAGATGCGTATCTACAGGAGGCTGAAGCG
CACGCGAACAACAGATCACTTTTTCATGCTGCAAAGGCGT
TCGAGCAGGCCGGGATGATGCTGAAGGATCTGCAGAGGAT
GCCAGAGGCCGTGCAGTACATCGAGAAGGCCAGTGTGATG
TACGTGGAGAACGGCACTCCGGACACCGCCGCCATGGCCC
TGGACAGAGCTGGGAAGCTGATGGAGCCGCTGGATCTGTC
CAAAGCTGTTCATCTGTACCAGCAGGCGGCGGCAGTGTTC
GAGAATGAGGAGCGACTACGGCAAGCAGCGGAGCTCATCG
GAAAAGCGTCAAGACTTCTTGTACGACAACAGAAGTTTGA
TGAAGCCGCTGCGTCTCTTCAGAAGGAGAAGAGCATGTAC
AAAGAGATGGAGAATTATCCCACGTGTTATAAGAAATGCA
TCGCTCAGGTTCTGGTCCAGCTGCACAGAGCGGACTACGT
GGCGGCGCAGAAGTGTGTGCGCGAGAGTTACAGTATCCCG
GGCTTCAGCGGGAGCGAGGACTGCGCCGCCCTGGAGGATC
TGCTGCAGGCGTACGATGAGCAGGACGAAGAGCAGCTGCT
GAGGGTCTGCAGATCACCGCTCGTCACGTACATGGACAAC
GATTATGCAAAGCTGGCCATCAGCCTGAAGGTGCCTGGAG
GAGGAGGAGGAGGAGGAGGAAAGAAGAAACCCAGCGCTTC
TGCTTCTGCTCAGCCACAGGAGGAAGAGGACGACGAGTAC
GCTGGAGGACTCTGTTAAAACACACACACGCACACACACA
CACACACACACACACACGCGCACACACGCACACACAATGC
AAGCTGGACTGGCATCCTCTGTGATCATCTCACCGTCGCT
GCATTAAACAAACACAAATGAAGTGCGTACGCCACGGGCT
CCTCTCTCTCAAGTACGTGTATTTATTCAGGTCTGCCTTT
ACACTTCATGTTCAGTTCCACAAGCTTTACAGGCAACACC
ACACCTGAGAAACAGCCTCTCCCGGTGGACGGACCTCCTC
GCAGACACCAACACTCATCCCGGGTAAATCAACAGTTCAC
ATCACATCAATATTCCCTCACACTTTACAGCAACGCTTCA
TGTTTTTACTCATTCACACGCACTGTAAACGTGACTGGTT
ACTTCAAAACCGTGAGTAAACCCATCGCAACACACACCTG
CAAGATGCCTTAATGTTATGCCCGTGCCTTTTCTGCACAA
TAATACAAATAACGCGATGTGTTTACGTACTGTTTGAATG
TAGACTGATTCCGTTATACAGCGGATAAACTGCCAGCGTC
ACCAATCACGTTAACTCAGCACTTCAGGTCATCGTGACGA
GCGCACATCAACACTTTAACAATGTTCTTAACCGCAATTG
ACCTTATACAGATGTAAAACTGTGCTCGTTATCATTACTT
AATGCGCATGATTGACGATGTTAACACAGATACATTTATT
GAACTGTCACAGCGGCGGATTTACCCATCCTAAACTATTC
CAGACACGTCTTTAAACGCACCATCACGCAGTCTGCTACT
CTGCATTACAGTGCGATACTACTGACAATAATAATAATAA
CAACATCATGTAAAGGATCTTGTAAAACTTTGAGTAATTT
TTTTCCACTAAACGATTTAACATTTATTTGACAATATCTA
GCATCTCAAATCCACTTCCCTCAACTAAATAATCGAAGCC
ATCCCTGTTTATATTGCATGTCAACACGTGTGCACAATAC
AAGCTATATTTTAACACATCTGTAACCCCTGACTTCCATA
CGATTTAGTTTTCCTGCCTTTTAACTTTCAGCTTTCTTCC
CGATGTCTTATTTTGTGTTCAGAAACTACTTTGGAAGCAC
TCAAGAGAGACGGTAAACACTGATTAAATTGTCTTTTTTG
GGTGAACTATTCCCTTCATTCCTATCATTACTGTTGTATG
TTTTTCTTTGACCAAATTAATTCTTGTGAGCGGGACAGCT
GCGCTCAAAAACACTCTAATATGCAATCACAGCTCTGAAT
ATGAACTATTATAAAACAGTTTCTTATCCAATTCCCTCAA
CTAAAGCTGTCCTATTTACATTACATGTCAACTGTAATGT
CATGTGTATTTATATAGCGCATTTATCGTGTATGGCCATA
CACCCAAATCGCTTCACAATCCACACCACCACCACCACCA
CCAATGATCCAACTGATCGTCATCTTAAGGTTCTGTCTGC
GTTCTGACTGATTTTCAGATATTGAGCGTAAAAGTTTGTG
CATTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations