header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120702-192
Transcript Name: napga-201
Previous Names: napga-001, napgl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055963 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055963|OTTDARG00000039031|ZDB-GENE-050320-46 napga|OTTDARP00000047620 napgl-001 LG_none FP245525.4,BX005461.9 Danio rerio protein_coding KNOWN, 2526 bp
ACAATCATCATCGTCAGCTGACAACACATCCAGCGTGCGA
GCGACAAACGAAGGTTTATTTACAGTATTTAATCATTTAT
GTGTAACGATTATGGCGCAGAAAATCAGCGAAGCTCACGA
GCACATCGCCAAGGCGGAGAAATACTTAAAGACGAGCTTT
ATGAAGTGGAAGCCTGATTATGACAGCGCTGCGTCTGAAT
ACGCTAAAGCAGCGGTCGCCTTTAAAAATGCTAAACAGCT
GGAACAGGCCAAAGATGCGTATCTACAGGAGGCTGAAGCG
CACGCGAACAACAGATCACTTTTTCATGCTGCAAAGGCGT
TCGAGCAGGCCGGGATGATGCTGAAGGATCTGCAGAGGAT
GCCAGAGGCCGTGCAGTACATCGAGAAGGCCAGTGTGATG
TACGTGGAGAACGGCACTCCGGACACCGCCGCCATGGCCC
TGGACAGAGCTGGGAAGCTGATGGAGCCGCTGGATCTGTC
CAAAGCTGTTCATCTGTACCAGCAGGCGGCGGCAGTGTTC
GAGAATGAGGAGCGACTACGGCAAGCAGCGGAGCTCATCG
GAAAAGCGTCAAGACTTCTTGTACGACAACAGAAGTTTGA
TGAAGCCGCTGCGTCTCTTCAGAAGGAGAAGAGCATGTAC
AAAGAGATGGAGAATTATCCCACGTGTTATAAGAAATGCA
TCGCTCAGGTTCTGGTCCAGCTGCACAGAGCGGACTACGT
GGCGGCGCAGAAGTGTGTGCGCGAGAGTTACAGTATCCCG
GGCTTCAGCGGGAGCGAGGACTGCGCCGCCCTGGAGGATC
TGCTGCAGGCGTACGATGAGCAGGACGAAGAGCAGCTGCT
GAGGGTCTGCAGATCACCGCTCGTCACGTACATGGACAAC
GATTATGCAAAGCTGGCCATCAGCCTGAAGGTGCCTGGAG
GAGGAGGAGGAGGAGGAGGAAAGAAGAAACCCAGCGCTTC
TGCTTCTGCTCAGCCACAGGAGGAAGAGGACGACGAGTAC
GCTGGAGGACTCTGTTAAAACACACACACGCACACACACA
CACACACACACACACACGCGCACACACGCACACACAATGC
AAGCTGGACTGGCATCCTCTGTGATCATCTCACCGTCGCT
GCATTAAACAAACACAAATGAAGTGCGTACGCCACGGGCT
CCTCTCTCTCAAGTACGTGTATTTATTCAGGTCTGCCTTT
ACACTTCATGTTCAGTTCCACAAGCTTTACAGGCAACACC
ACACCTGAGAAACAGCCTCTCCCGGTGGACGGACCTCCTC
GCAGACACCAACACTCATCCCGGGTAAATCAACAGTTCAC
ATCACATCAATATTCCCTCACACTTTACAGCAACGCTTCA
TGTTTTTACTCATTCACACGCACTGTAAACGTGACTGGTT
ACTTCAAAACCGTGAGTAAACCCATCGCAACACACACCTG
CAAGATGCCTTAATGTTATGCCCGTGCCTTTTCTGCACAA
TAATACAAATAACGCGATGTGTTTACGTACTGTTTGAATG
TAGACTGATTCCGTTATACAGCGGATAAACTGCCAGCGTC
ACCAATCACGTTAACTCAGCACTTCAGGTCATCGTGACGA
GCGCACATCAACACTTTAACAATGTTCTTAACCGCAATTG
ACCTTATACAGATGTAAAACTGTGCTCGTTATCATTACTT
AATGCGCATGATTGACGATGTTAACACAGATACATTTATT
GAACTGTCACAGCGGCGGATTTACCCATCCTAAACTATTC
CAGACACGTCTTTAAACGCACCATCACGCAGTCTGCTACT
CTGCATTACAGTGCGATACTACTGACAATAATAATAATAA
CAACATCATGTAAAGGATCTTGTAAAACTTTGAGTAATTT
TTTTCCACTAAACGATTTAACATTTATTTGACAATATCTA
GCATCTCAAATCCACTTCCCTCAACTAAATAATCGAAGCC
ATCCCTGTTTATATTGCATGTCAACACGTGTGCACAATAC
AAGCTATATTTTAACACATCTGTAACCCCTGACTTCCATA
CGATTTAGTTTTCCTGCCTTTTAACTTTCAGCTTTCTTCC
CGATGTCTTATTTTGTGTTCAGAAACTACTTTGGAAGCAC
TCAAGAGAGACGGTAAACACTGATTAAATTGTCTTTTTTG
GGTGAACTATTCCCTTCATTCCTATCATTACTGTTGTATG
TTTTTCTTTGACCAAATTAATTCTTGTGAGCGGGACAGCT
GCGCTCAAAAACACTCTAATATGCAATCACAGCTCTGAAT
ATGAACTATTATAAAACAGTTTCTTATCCAATTCCCTCAA
CTAAAGCTGTCCTATTTACATTACATGTCAACTGTAATGT
CATGTGTATTTATATAGCGCATTTATCGTGTATGGCCATA
CACCCAAATCGCTTCACAATCCACACCACCACCACCACCA
CCAATGATCCAACTGATCGTCATCTTAAGGTTCTGTCTGC
GTTCTGACTGATTTTCAGATATTGAGCGTAAAAGTTTGTG
CATTCC

napga TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA napga-201 2526
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
napga-201 Contained in:
[Fosmid] CH1073-433P8 (1) (order this)
OTHER napga-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055963 (1)
  • Ensembl_Trans:ENSDART00000063151 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091448 (1) 1234bp
    GenBank:EV760196 (1) 1060bp
    GenBank:BC164747 (1) 985bp
    GenBank:CO245483 (1) 860bp
    GenBank:CT678527 (1) 779bp
    GenBank:EX153641 (1) 664bp
    GenBank:CT678528 (1) 628bp
    GenBank:AW175402 (1) 493bp
    CITATIONS (2)