header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-810
Transcript Name: pkma-201
Previous Names: pkm2a-001, pkma-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052968 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052968|OTTDARG00000037185|ZDB-GENE-031201-4 pkma|OTTDARP00000041655 pkm2a-001 LG_ CU607069.15 Danio rerio protein_coding NOVEL, 312 bp
GAAGTAGTGCCGGTAGGTTTGGCAGATCACCTTGAGCTGG
GGAACCGGAGCGCATCAGTCAGTCATTCAAGGCCGACCGT
CAGCAAGAGCAGGATATTACCAGTCTCCTCCACGATGTCT
CAAACTAAAGCTCAGGATATGGGCTCTGCCTTCATCCAGA
CGCAGCAGCTCAATGCTGCCATGGCCGACACTTTCCTGGA
GCACATGTGTCTGCTGGACATCGACTCCGAGCCCACCATA
GCTCGCAACACTGGAATCATCTGCACCATCGGACCGGCCT
CCCGCTCAGTGGACACACTGAAGGAGATGATC

pkma TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pkma-201 312
pkma-204 (1) 325
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pkma-201 Contained in:
[Fosmid] ZFOS-1243C12 (1)

OTHER pkma-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000052968 (1)
  • Ensembl_Trans:ENSDART00000161206 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045421 (1) 2412 bp
    GenBank:BI876462 (1) 759 bp
    CITATIONS (2)