header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-81
Transcript Name: zgc:158464-201
Previous Names: ch73-116f3.3-001, ottdart00000053135, si:ch73-116f3.3-001, zgc:158464-201 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053135 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053135|OTTDARG00000037280|ZDB-GENE-120215-147 si:ch73-116f3.3|OTTDARP00000041788 CH73-116F3.3-002 LG_none CU896640.11,FO082029.2,FP102030.4 Danio rerio protein_coding NOVEL, 443 bp
TTCAGTTTGATGGTGTGGAGAAGAATCGTCCTCTGCAGCG
TCACTCCAGCGCCTGTCTGGTCAACATGAAGACGAGTTCA
GTCGATCAGAGCGTTGGAGAGAGAATCGACCCCGCTCTGC
CACTAGAGGGACAGTTCTGGTATCATGGTGCCATCAGCCG
CACAGATGCAGAAGCTCTGCTCAGACTGTGTAAAGAGGCC
AGTTACCTGGTCAGAAACAGCGAGACCAGCAAGAACGACT
TCTCACTCTCGCTTAAGAGCAGTCAGGGCTTCATGCATAT
GAAGCTCTCGCGGACCAAAGACAGTAAATATGTGCTGGGT
CAAAACAGCTGCCTGTTCGACAGCGTTCCCGAGATCATCC
ACTATTACTCCAGCCGCAAACTACCCATTAAAGGAGCCGA
GCACATGTCTCTGCTGTACCCCGTGGCCATACGGACACTA
TAG

zgc:158464 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA zgc:158464-201 290
zgc:158464-202 (1) 1286
zgc:158464-203 (1) 4094
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:158464-201 Contained in:
OTHER zgc:158464-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053135 (1)
  • Ensembl_Trans:ENSDART00000158687 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL919208 (1) 539bp
    CITATIONS (3)