Transcript

naa20-201

ID
ZDB-TSCRIPT-120213-798
Name
naa20-201
Previous Names
  • naa20-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052859 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052859|OTTDARG00000037107|ZDB-GENE-050327-47 naa20|OTTDARP00000041561 naa20-001 LG_ CU855808.6 Danio rerio protein_coding KNOWN, 779 bp
AAAACGTACGTGTGACGTAGGGGTGAGAGGTCAGAGCGTC
GTCCTGTCCTGCAACACACTGGAAAATGACAACATTACGA
GCTTTCACGTGCGATGATCTGTTTAAATTCAACAATATTA
ATCTGGACCCCCTGACAGAAACATATGGAATTCCCTTCTA
TCTTCAGTATTTGGCTCATTGGCCGGAGTATTTCATAGTA
GCTGAAGCTCCAGGCGGTGAACTGATGGGCTACATCATGG
GAAAGGCCGAGGGCTCCGTCGCCAGAGAGGAATGGCACGG
GCACGTCACTGCCCTCTCTGTGGCCCCAGAGTTCAGACGG
CTGGGTCTGGCTGCGAAACTCATGGAGATGTTAGAGGAGA
TCTCAGAAAGAAAGGGCGGATTCTTTGTGGATCTCTTTGT
GCGAGTTTCCAATCAAGTTGCAGTGAACATGTACAAACAG
CTCGGCTACAGCGTGTACAGAACGGTTATAGAGTATTACT
CTGCCAGTAACGGTGAACCTGATGAAGATGCTTATGATAT
GAGGAAGGCTTTATCCAGGGACACAGAGAAGAAATCCATA
ATCCCGCTTCCACATCCTGTCCGGCCAGAAGATATTGAAT
AACACTAAGATGTGGCTCTCTGAAATCATCAAATTTCAGC
TGGGAAAACAGACTTTTTGCTTTTATGGGACAAAATATTG
TTTTGAAATGTCAGAGAGCCACAGATTATCGGGTTAATAA
AGCTGATGCTAAATGACATTGGAATTGTAGTTACATGAAA
TAAAACGATTAAGCAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations