Transcript

poldip3-203

ID
ZDB-TSCRIPT-120213-793
Name
poldip3-203
Previous Names
  • poldip3-002
  • ch1073-314i13.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052788 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052788|OTTDARG00000037047|ZDB-GENE-120201-2 poldip3|OTTDARP00000041494 CH1073-314I13.2-002 LG_none CU672266.35,FP245516.9 Danio rerio protein_coding PUTATIVE, 1393 bp
ACAGGCCTGTATATGGCAGAGGGGCGGGGCCACTGAACAT
GGCCTTTGATGCCCGGCAGAAGATTGGCAGTGGTGATGTC
AGACAGAGGCTGGGAGTGGGTGGAGCCAGCGGGGGGAAAC
GCCTCCAGATTTCGGCTAGCGGAGCTGCAGTTCAGACTCT
GTCGCGGCCGTCAGTGTTTCCGGTGAAGGACGCCAGGGAG
AAGCTGGGCCAGAAAGACGCTCGGCTGCGGCTGCGGGGCC
GAGGAGGTGGGACCAGTGCTGTGCAGAGCCGAGGGGGAGG
GGCCAGTGCGATGCAGGACGCCCGGCTGATGATCAACCTG
CGCAAACAGCAGCAGCAGCAGCCGTCCGCCAGCGGCCCCG
CCCCAGCCTCCGCCCGGCCCAGCGGCCCCGGGGTCCCACA
CGTACACATACACAACACCAGCCCTCGCGCACACACACTC
ACCACCAGAGTGGGTGTGGCCTTACAGCCAGGGGGCGGGA
TCACAAAAGTTGTTGATGCACGTGATAGGTTGAGCTTGAA
GAGGAGTGTCCCTACGACGTCCAATCAGAGCGCAGCGTCT
CTAAAGATCACCAAAACCATCCAGAGGCCTGTGGGAATGA
CCAGCGGCATCCGGATCAACGTCCCCAGTGCAGCACCTCC
GCGTGTGTGTGCTGCTGCTGAAGATGAGGATGAGGATGAT
GTCAGTGCTGTGATTCCCAGCAAACAGATGAAGATCACTG
CTGCCAGCAGCCTGCAGACACGGGCGGGGCCTGTCTCTCT
CTCCGCCCCCATCACTAAGGTGGTAAAGAACGACTCGTAC
ACGCCCCCATCTGTCTCGGTGCCGCCCGCTCGCCCTGCAC
CCCGCCCCCCCACACAGAGCCTGCAGCCCGTCTCCAGGAC
GACCGTTACTACGCAGCCTGCGGGCAGAGACACCAGCGCC
CAGACACACACACCCACACAGCCTGTCTTCAGTCCTCTGG
AAGGCACAAAGATCACCGTGACGAATCTCCACCCGCGGGT
GACGGAGGAGGATATTGTGGAGCTGTTCTGTGTGTGTGGC
GCACTCAAGCGGGCACGGCTGGCCAAAGTGGGCGTGGCTG
AGGTGGTGTTTGTGCGCAAGGAGGATGCAGTCAGTGCCTA
CAGGAAGTACAACAACCGCTGTCTGGACGGTCAGCCGATG
AAGTGTAATCTGCACATGCAGGGCAGCGTGATCACGTCTG
ACCAGCCCATCCTACTGAGGTTGAGTGATACTCCTGGTTC
TCCGCTGTCCGCACAGAAGGCCTCCTCCTCTTCCTCCTCC
CGCTCCTCCAAGTCCTCGTCTGCAGCTGAGGTGGACCCGC
AGACCATCTTGAAGGCGCTCTTCAAGTCTTCCTCCTCCTC
CTCCTCTTCCTCCAGCCAGACGGCCAGCAGTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations