Transcript

si:dkey-166k12.1-201

ID
ZDB-TSCRIPT-120213-776
Name
si:dkey-166k12.1-201
Previous Names
  • dkey-166k12.1-001
  • si:dkey-166k12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030561 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030561|OTTDARG00000023464|ZDB-GENE-120215-78 si:dkey-166k12.1|OTTDARP00000042587 DKEY-166K12.1-001 LG_none BX571688.3,BX950855.14 Danio rerio protein_coding NOVEL, 3014 bp
GCAGCAGTGGATGGGGTCGCGCGGGACTAATTTACACACA
GCTTTGATCTACAGACTCATTATGCGCGTGCGTGTCCCAT
TTACACCAGCTCCGCTAAAACATGCTCATGTGCAGGATCT
TACTACTCCAGACAAAGCGAGAGATACTTTTTGCTTGTCT
TATTCGTCAAGATTGCTAGTCGATTGAGTTACATTCAAAC
TTGCGATCCATTCCAGACGATATGTGATCCTGCTCCGGTT
TTCGGCTTTCCCTATTTTGTAACAGAAGCGGAGCGCGCGC
GGGTGTATATTTATTTTTGGAGATACCGAACAGTTAGATG
GATACAAAAGACGTCATTAAAGTGGACATCAGCTCAACGT
GGTTTTCTTAAGCTGTTTATGATCGCGTTTATGATTGCAT
CAGTGGAGAACTGGACTTTCTGGAGCGTTTCTTAAACCTC
AAGATATCATTTTGTTTCTTGCATAATAACAATAACAACA
CATATGGCACGTGCTGCGTAACTATTAGTCTCTGCGCGCT
TTTACGGAATAGATGGTTGGGATTTTTATCGCTGTAATGT
GATGGACATCAGTTCAACATGATTTGTTTTAGCTTTGAAT
GATCGTGGTTTCTTGAGCAGATCCGGAGAAAATGACTTTC
TTTAGAGTCATTTAAACCTCAAAATATAATTTAGTTTCTT
GCATAATGATAATAATTAATTACACAATGGCACGTGCTGC
GTAAAGTATTCATCCATCCGCGCTTTATTATGAATAGATA
GTTATGATTTTGTTATTCTATCGTGATATTCGCTGTACTT
TGATGGATGTGTGAGGAAAAACATACGTCTGTAAAGTGGA
CATTAGTTTAACATTATTTATTTTAGCTTTTAATGATTGT
GTTTTTTTGGGCAGGTCCGAGGAAAATTACTTTCTTGAGC
CTTTTTAAAAATATATCATGTTCATTCTTGCATATTTGCC
TTATAACAACAGGAACACAATGGCACGTGCTGCGTAAAGT
AGCCTATTATTGATCTCTGCGGCTGCGCGCATTCTTGTGA
ATATATGTTGTGATTTTTTGTGTATTCTGATTGATGTGTG
AGAGAAAAAAGACGATTAGTAAGTGGAAATCGGTTCAACA
TAATTTATTTTAGCTATTAATGATAAATATTACATTCCTG
AGCGATTTTTACAACCTTAAAATATAATTTTCATTCTTGC
ATATGAACAACCACACAATGGCACGTGCTGCGTAAAATAC
TATTGATCTCTGCGCGCTTTCTTCTGAATAGATTATTTGA
TTTTTGTTGTGTGATACTTACCTTATTTTGAGGGTGGTGT
AAGGCTAAAAAGTCGGGAATGAATTTCGATCAGCTACTGG
CCACAATCGGTGGCTTCGGGAAATATCAGAAGCTTCTGTA
TGTCTGGATTTGTTTACCTCAGATTTTTCTCGGGTTTCAC
ATGATGGCGAGCGTGTTTACAGGCGCCACACCACCACACC
GCTGTCGGGGTTCAACTTCAGGGATGGAGGACTGGACTTT
TACCTCCAATCTTTCACATGTGAACTTGAGCATCTCCCGT
CTGGCCGGATTCGCGGACGCGTGCACGGCGGCTTCAGGAG
TGAACCGGAGCGCGCGCACGAATTGTGAGACTGGATGGGT
TTACAGCCACGAGGTTTTTCAGAGCACCACTGTCACTGAG
TGGGACCTGGTGTGTGATAAGAGAGGTCTGAGCAGTCTGG
GCTCCTCCATCTACATGCTGGGTCTGCTTGTAGGAGCTGT
TGTATTTGGAGCAATGGCAGACAGGTATGGGAGGAGGTTT
GCCATGCTTGTGTCTTTGGCTCTTCAGACGGTGTTTGGTG
TTGCTGCTGCCTTCGCCCCAAACTTTCCTGTTTATGTCGG
TCTGCGCTTCATCATAGGAATGACTGTGTCGGGGGTGATA
ATCAATGCATTTGTGCTAGGCACCGAGTGGACTTGCACAC
AGAGACGGATGCTGGCCGGCATCTTCACCGACTACTTTTT
CGGTTTTGGCTACATGTTGCTGGCTGGTGTGGCTTTTCTC
ATCAGAGACTGGAGGAAACTGCAGCTGGCCATCTCTGCTC
CTGGCTTTCTCTTCATATTCTATATCTGGGTTCTTCCACA
TTCTGCCCGCTGGCTGCTGGTGAATAACCGGAAAGAGGAG
GCGATTGATCTTCTGCGTAAAGCAGCTTCGGTCAATGGCC
GCACCTTGCCTCCCACTGTTCAGGTGGAGAGATATGAGAG
CCCACAGGGACGTAGTAAGTATACAGTGGTCGACCTGCTT
CGAACTCCACAGATGAGGAAGAGAGCGCTCATACTCTTCT
ACATCTGGTTTGTTAATGTACTGGTGTATTATGGTCTGTC
TCTGGGAGTGTCTGACCTCGGCGCTGACCTTTACCTCACT
CAGTTCATGTTTGGATTGGTGGAGATTCCTGCCAGGACGC
TGGTGTTGGTTCTCCTGCCCTGCAGTCGGAAGATCCCGCT
GAGTGTGTTTCTGGTCGTTGGAGGAGGAGCATGTCTGCTC
ACCCTCACTCTTCCAGCAGACAGTGCTCATGTTCGGACAG
CTTTGGCCATGGTGGGGAAATTTGGAATTACAGCATCCTT
TGCAATCATCTATGTTTATTCTGCAGAACTTTTCCCGACC
GTCCTCAGACAAACAGGTATTGGTGTTTCATCTATGTTTG
CGCGGATGGGTGGAGTTCTAGCGCCGCTAATAAACCTGCT
GGGCCGTCACACACCTGTTGTGCCAATGCTGATCTTCGGC
TCCACACCTCTGCTAGCTGCAGCGCTCGCTTTAGCACTGC
CCGAGACTGCCAGACAACCACTGCCCGACAGCATTCATGA
TACAGAGAAGTCTACTCTGAAATATGATGGACAAATTCCT
GTACAAGCCAGTCAATCACCAAACAACACAGAAGGACAAG
AACTGCAGAGTTTAGCAGATGAGTGTAGATAGACAGACAC
AAACACACACTTGTTTTTGTCAATTGTGAGGACATTGAAT
AGGTTTCCACTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations