Transcript

si:ch211-233f16.1-001

ID
ZDB-TSCRIPT-120213-773
Name
si:ch211-233f16.1-001
Previous Names
  • ch211-233f16.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020599 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020599|OTTDARG00000015676|ZDB-GENE-120214-1 si:ch211-233f16.1|OTTDARP00000017397 CH211-233F16.1-001 LG_none CR759867.5,CT009673.11,CR555294.10,CU571334.17,CU896634.18,CU905503.4,CU856372.12,CU856353.4,CU856541.5,CR352286.6,CT990626.6,CU019666.7 Danio rerio protein_coding NOVEL, 11013 bp
AGAATTGCAGAGCAGTTCTTGTGGGAACCCTGGCGTCCCG
CCTAAAGGCATTCTGTACGGGACGCGCTTTAATGTAGGCG
ACAAGATCCGCTACAGCTGTGTGACCGGCTACGTGCTGGA
CGGCCATCCGCAGCTCACCTGTGTGACTAATGCAGGCAAC
GCTGCCGTATGGGACTTTCCAGTGCCCATCTGTAGAGCTG
AGGACACATGTGGTGATACTCTGAGGGGTTCAAGTGGCAT
CATTACGAGTCCCAATTTCCCGAGTGAATATTACAATAGT
GCGGACTGTACGTGGACCATACTTGCTGATCCCGGAGACA
CCATTTCCATCATTTTTACAGACTTCCAGACGGAGGAAAA
ATACGATTATTTGGAGGTGGAGGGGTCCGAGCCGCCAACA
ATATGGCTCTCCGGCATGAATGTCCCATCTCCTATTGTTA
GCAACAAGAACTGGCTGAGACTTCACTTTGTTACTGACAG
CAACCATCGATACAAAGGCTTCAGCGCTCATTATCAAGTG
AAACGGTCTGTAGATTTCAAATCTAGAGGAGTAAAATTAT
TCCCTGGCAAAGACAACAGCAACAAGTTTTCTATCTTAAA
TGAAGGAGGAATCAAACAGGCTTCAAACTCGTGTCCGGAC
CCAGGGGAACCGGAAAATGGCAAACGCATTGGCAACGACT
TTAGTATTGGTGCCACAGCCGAGTTCACCTGTGATGAAGA
TCATGTTCTCCAGGGCTCCAAAAGCATCACGTGTCAGAGA
GTGGCGGAGGTGTTCGCCGCATGGACGGATCATAGACCTG
TCTGTAGAGTGAAAACTTGCGGATCAAACCTTCAAGGTCC
GTCTGGGACTTTCAGCTCACCCAATTTCCCCATTCAGTAC
GAGAGCAACTCGCAGTGTGTGTGGATCATCACGGCCAGCA
ACCTCAACAAGGTGATTCAGATTAACTTTGAGGACTTTGA
CCTGGAGCTGGGCTACGATACGCTAACCATCGGTGACGGA
GGGGAAGTTGGAGACCCCAAAACCATCCTGCAAGTTCTGA
CTGGAAGCTTTGTCCCAGACCTGATCGTCAGCATGACCCA
TCAGATGTGGCTTCACCTTCAGTCTGATGAAAGCGTGGGC
TCCATAGGCTTCAAGATCAACTACAAAGAAATCGACAAGG
AGAGCTGTGGGGACCCAGGCACCCCGCTGTATGGGATGAG
GGAAGGAGACGGCTTCTCCAACGGTGACATGCTTCGCTTT
GAGTGCCAGTTTGGGTTTGAGCTCATTGGAGAGAAAACAA
TATCCTGTCAGAACAACAACCAGTGGTCTGCCAACATCCC
CATCTGCATTTTTCCCTGTCTCTCCAACTTCACTGCTCCC
ATGGGCACGGTCCTGTCTCCGGATTACCCAGAGGGCTATG
GAAACAACCTGAACTGCGTGTGGCTGATCCTATCAGAGCC
TGGCAGCCGCATCCACTTGGCCTTCAATGACTTTGACCTG
GAGGCTCCGTACGACATCCTGACGGTGAAGGATGGAGAAA
TGCTGGACTCGTCAGTTCTGGGCCGCTTTACCGGGGCGGA
GGTGCCTTCACATCTCACCAGCAACAGCAACATCCTGAGG
CTGGAGTTCCAGGCGGACCACTCCATGTCCGGCAGAGGAT
TCAACATCACTTACACCACATTTGGCCATAACGAGTGTCC
AGATCCAGGCATCCCACTGAACGCCAGGCGTTTTGGTGAC
AGTTTCCAGCTGGGCAGCTCCATCTCCATCATCTGCGAGG
ATGGCTTCATTAAGACCCAGGGAGCCGAAACCATCACTTG
TGAGCTGAACGGTGGAAAGGTGATGTGGAGCGGCCCCATC
CCAAAATGTGAAGCTCCCTGTGGAGGACACTTCTCAGCTC
CTAGTGGTGTCATTTTATCTCCCGGCTGGCCTGGTTACTA
TAAGGACTCACTCAACTGTGAGTGGGTCATAGAAGCTGAA
CCCGGACGCTCCATTAAAATCACATTTGAGAAATTTCAGA
CAGAGTTGAACTGTGATTTCCTGGAGCTTCACGACGGGCC
CAATCTTCTCTCTCCTCTGATTGGTTCGTTCAATGGCACT
CAGGTGCCTCAGTTTCTCTTCAGCAGTGGAAACCACCTGT
ACATGCTCTTCACCACCGACAACAGCAGATCCAACAGCGG
CTTCAAGATCCTGTACGAAAGCGTAACAGTGGATGCTTAC
TCCTGCCTGGATCCAGGGATTCCAGTCAACGGTCTCCGCT
ACGGTCAGGATTTCTCCATCGGCTCTACCGTGTCCTTTGG
CTGTGACTCTGGTTACCGTCTCAGCCATGAAGAGCCGCTG
GTCTGTGAAAAGAACCACTGGTGGAGCCACCCGCTGCCCA
CCTGTGACGCCCTGTGTGGAGGTGATGTTCGAGGACCAGG
AGGAACCATCCTGTCCCCCGGCTACCCTGAGGTTTATCCC
AGCTCCCTCAACTGCACCTGGACTGTGGAGGTCAGCCATG
GCAAAGGCGTTCAGTTCACCTTTAACACCTTCCACCTGGA
GGACCATCATGACTATCTGCTCATCACAGAAAACGGGAGT
TTTGTTCAGCCTCTCGCTCGTCTCACCGGAGCTGAACTGC
CCTTGCCCATCAACGCAGGTCTTTATGGCAACTTCAAGGC
CCAGCTGCGCTTCATATCTGATTTCTCCATCTCCTACGAG
GGCTTCAACATCACATTCTCAGAATACAACCTTGAGCCGT
GTGAGGATCCAGGTGTGCCGCATTACGGGCGGCGTAACGG
ATACAGCTTCGGTATCGGAGACACTCTGACCTTCTCCTGC
AATCTGGGCTACCGTCTGGAGGGAGCACCGGAAATCATCT
GCCTGGGAGGAGGGCGGCGCATGTGGAGCGCACCTCTGCC
AAGGTGTGTGGCTGAGTGCGGCTCTTCTGTCATCAACAAT
GAAGGGATTCTGCTGTCACCCAATTACCCCATGAACTACG
AGAACAACCACGAGTGCATTTACAGCATACAGGTGCAGGC
TGGGAAAGGAATCAACATTTCGGCTAGAACCTTCCATCTG
GCACAGGGGGACATCCTGAAGATCTATGATGGTAAAGACA
ACGCGGCTCACATGCTGGGGGCCTTCACCGGCTCCTCCAT
GTTGGGTCTGACCCTGATCAGCACCTCCAATCACCTCTGG
CTGGAGTTTTACAGTGATGCCGAGGCTACCGGAGAGGGCT
TCAAACTGGTGTACTCCAGTTTTGAGCTGTCCCACTGCGA
AGACCCCGGTGTGCCCCAGTTTGGCTTCAAAGTCAATGAC
CAGGGCCATTTCTCTGGCAGCACCATCACCTACAAGTGCG
ACCCCGGCTACACACTCCACGGCAGCGGCGTGCTCAAATG
CATGACCGGAGAGAGACGCGCATGGGATAATGCTCTTCCT
TCCTGCATAGCTGAATGCGGTGGACGTTTTAAAGGAGAGA
CGTCAGGACGCATTTTGTCGCCTGGTTATCCATTCCCATA
TGACAATAACCTGCGCTGTACGTGGATGGTGGAGGTGGAT
TCAGGAAACATCATCAGCCTGCAGTTTCTGGCCTTCGACA
CCGAAGCCTCTCATGACATCCTTCGGGTCTGGGACGGTCC
TCCAGAAAATGAGATGTCTCTGAGGGAGGTGAGCGGCTCG
CTGCTCCCCGAAAACGTCCACAGCACCCTCAACATGGTCA
GCATCCAGTTCGAGACCGACTTCTACATCAGCAAGTCTGG
ATTCGCCATCGAGTTCTCCAGTTCGGTGGCCACAGCCTGC
AGGGATCCTGGAGTCCCGATGAATGGCAGTCGTAATGGAG
ACGGTCGTGAGCCTGGAGACACAGTGACCTTCCAGTGTGA
TCCTGGATATGAACTTCAGGGAGACGTGAAGATCACCTGC
ATCCAGGTGGAAAACCGCTACTACTGGCAACCCAGCCCTC
CAGTCTGTATAGCTCCATGTGGAGGGAATCTCACTGGTTC
CTCTGGCTTTATTCTGTCGCCCAACTTCCCTCATCCGTAC
CCGCACAGCAAAGACTGCGACTGGCTGATAGCCGTCAACT
CTGATTACGTCTTATCCCTCGCATTCATCAGCTTCAGCAT
CGAGCCCAACTACGACTTCTTGTACATCTATGATGGAGCG
GACAGCAATAGCCCTCTGATCGGGAGCTTTCAGGACAGCA
AACTTCCAGAGCGGATAGAGAGCAGCTCCAACACCATGTA
CCTGGCCTTTCGCAGCGATGGATCTGTCAGCTACACTGGA
TTCCACCTGGAGTACAAAGCTAAGCTGAGGGAGTCATGCT
TTGATCCCGGTAATGTGATGAATGGCACTCGGTTGGGCAG
CGACTACAAGCTGGGCTCCACTGTGACCTTCTACTGTGAG
GCGGGCTACGTCCTCCAGGGCTACTCCACGCTTACCTGCA
TTATGGGTGATGATGGCAGGCCTGGCTGGAACAGGGGACT
GCCCAGCTGTCAAGCGCCATGTGGAAGTCGCTCTACTGGG
ACAGATGGGACCGTGCTGTCACCCAATTTCCCGAGGAACT
ACACGACGGGACAGAGCTGTGTGTACACTATCGCCGTACC
CAGGGAGTTTGTTCTATTCGGACAGTTCGTCCTGTTCCAG
ACGTCTCTGAATGATGTGGTGGACATTTATGATGGGCCGA
CACAACAGTCTTCTCTGCTGTCCTCTCTCTCCGGCTCGCA
CTCAGGGGAGTCTCTGCCCTTGAGTACTGGAAATCAAATA
ACTATCAAGTTCAGTACAGTTGGACCAGAGACGGCCAAAG
GCTTTCATTTTGTGTATCAAGCTGTACCGAGGACCAGTGC
CACGCAGTGCAGCTCAGTTCCAGAGCCTCGCTTCGGCAAA
CGCATTGGCAACAACTTCGCTGTGGGGGCGTCAGTGATGT
TCGAGTGTAACCCAGGCTACACGCTCCACGGCTCCACTGC
CATTCACTGTGAAACCGTCCCCGATGCCCTCGCTCAGTGG
AACGACACCCTGCCCACCTGCATCGTGCCTTGTGGAGGGA
TTCTGACAATGCGAAAGGGGACGATTTTGTCCCCAGGATA
CCCGGAGCCCTACGATAACAACCTCAACTGCGTGTGGAAG
GTGTCTGTTCCTGAGGGAGCTGGGATACAAATCCAAGTTG
TGAGTTTTGCCACTGAACACAACTGGGATTCCCTGGATTT
CTATGATGGCGCAGACAACAATGCACCCAGACTGGGCAGC
TATTCAGGGACCACCATTCCTCAGCTCCTGAATAGCACGT
CTAATAACCTCTACCTGAACTTCGTGTCAGACATCAGCGT
GTCCGCAGCAGGTTTCCATCTGGAATACACAGCTATTGGC
TTAGATACATGTCCAGAGCCTCAGACTCCAACCTATGGGA
TTAAAATTGGCGATCGATACATGGTGGGAGATGTTGTCAT
GTTCCAGTGTGAGCAAGGATATTCTTTACAGGGAAATGCC
CATATCACATGTATGCCTGGACCAGTGAGGAGGTGGAACT
ACCCGGTCCCTCTCTGCTTAGCTCAGTGTGGTGGGGCCAT
GACGGAGGTTAGCGGAGTGATTCTGAGCCCTGGTTTTCCT
GGCAACTACCCGAGTGGTCTGGATTGCACCTGGACCATCA
CCCTGCCCATTGGCTTTGGAATCCATGTCCAGTTCCTGAA
CTTCTCCACTGAGGCAATTCATGATTACCTGGAGATCCGA
AGCGGGCCCAGTGAGACCGGCACAGTGATCGACCGCTTCA
GTGGACCACAGGTTCCTGAGTCGCTCTTTAGCACCACTCA
TGAAACCAGCTTCTTCTTCCACAGCGACTATTCTCAGAAT
AAACCCGGATTTCACATTACATACCAAGCCTACCAGCTGC
AGAGTTGTCCTGACCCCCGACCTTTCAGGAACGGTATTGT
AATCGGCAGTGACTTCAGCGTGGGCATGACGGTGTCTTTC
GAGTGTTTACCCGGTTACTCTCTGATCGGCGAGACCTCTT
TAACCTGCCTGCATGGAATCAGCAGGAACTGGAACAACCC
CATACCACGCTGTGAAGCTCTATGCGGTGGAAACATCACC
TCCATGAATGGCACCATCTTCTCTCCGGGACACCCAGCCG
AATACCCCAATTTCCAGGACTGCGTCTGGAGCGTCCGAGT
GCCTCCTGGAAACGGCATCTATATCAACTTCACTGTGCTC
AGCACTGAACCCATCTACGACTACATCACTGTTTGGGATG
GTCCAGACCAGAGTTCGCCTCAGATCGGTCAGTTCAGCGG
AAACACAGCGCTGGAGTCTGTCTACAGCACATCCAACCAG
ATCCTCATCAAGTTCCACAGTGACTTCAGTGGAAGTGGCT
TCTTTGTGCTGAGTTACCATGCCTACCAGTTACGAGTGTG
CCAGCCTCCCCTGGAGGTGGCAAATGCTGATATCCTGATG
GAGGACAATGAGTTAGAAATAGGTGATATCATCCGCTATC
GATGCCACCCTGGATTCACCCTGGTGGGGAGCGAGATTTT
GACGTGCAGGTTAGGAGAACGGCTACAGATGGACGGACAC
CCCCCATCCTGCCAAGTTCAATGTCCAGCTCATGATGTCC
GATTCGACTCCTCTGGGGTGATTTTGAGTCCTGGGTATCC
GGACAGTTACCCCAACCTACAGATGTGTTCATGGAGCATC
AATGTGGAGAAGGGCTACAACATCACCCTGTTTTTTGAGT
TCTTCCAGACCGAGAAGGAATACGACATTCTGGAAGTCTT
TGATGGACCCACCATTCACAGTCAGACCCTGGCCACACTG
AGCGGCGATCTACCCACACCCTTCAACATGACCACCAGCG
GCCACCAGCTGCTCCTGCGCTGGTCTGCAGATCACGGCAC
CAACAAGAAGGGGTTCAGCATCCGCTATGTCGCTCTGTAC
TGCAGCACTCCAGACTCTCCTCTTCATGGATCTATAAGCA
GTCAGACCGGAGGACACCTCAACAGTCTGGTTCGCTGGAC
CTGTGACCGAGGGTACCGACTTATAGGAAAAAGCACAGCC
GTCTGCAAGAAAACCCCCTTCGGCTTCTATGACTGGGACG
CCCCGGTTCCTGCTTGCCAAGCCGTGTCCTGTGGAGTGCC
CAAGGCTCCAGTGAACGGAGGAGTGCTTGCGATGGACTAC
TCGGTGGGCACACGTGTGACCTACTTCTGCAGTGATGGCT
ACCGGCTGTCCTCCAAAGAGCTGACCAGCGCTGTGTGCCA
GCCTGACGGCACCTGGAGCAACCACAACAAGGTCCCTCGC
TGCTCAGTTGTGGTTTGTCCGAGTATCGGATCTTTTTCTC
TGGAACATGGAAGATGGAGGATCGTTAACGGCTCGCATTA
TGAATACAGAACCAAAATCATCTTCACCTGCGATCCTGGC
TATTACCGCCTCGGGCCGGCTTACATTCAGTGCATGGCCA
ACGGAGCGTGGAGCTGGAAGAACGAGAGACCCCACTGCCA
GATCATCTCTTGTGGGGATCTCGCTACGCCTCCCAGTGGA
AAGAAGATTGGAACGCAGACGTCCTTCGGGGCCACAGCCA
TATTTACATGTGACAATGGCTATATGCTGGTGGGCTCGAG
CGTGCGCGAGTGTCTGTCTTCTGGGCTGTGGAGTGGAACA
GAGACGCGCTGCTTGGCCGGTCACTGTGGTTTACCAGAGC
AGATCGTCAACGGGCAGGTGATCGGGGAAAACTTCGGCTA
CAGAGACACAGTGGTTTACCAATGCGTCTCCGGCTTCCGG
CTCATCGGATCCTCTGTGCGCATCTGCCAACAAGACCACA
ACTGGTCCGGACAGCTGCCCATCTGCGTCCCCATCAGCTG
CGGGCACCCGGGCAGCCCCATCTATGGCCGCACCATCGGC
AACGGCTTCAACCTGAACGATGTGGTGAGCTTCTCCTGCA
ACATGGGCTACGTGATGGAGGGTCCGTCCCGAGCCCAGTG
TCAGGCCAACCGGCAGTGGAGTCAGCCACCACCAACATGT
AAAGTTGTCAATTGCTCTGACCCTGGGATTCCCGCCAACT
CTATCAGGCAGAGTAAGATCGAGCATGGAAACTTCACCTT
TGGCACGGTGGTTTTCTACGACTGCAACCCCGGTTATTAC
CTGTTTGGCTCACCTGTCCTCACCTGCCAGCCCACGGGTC
AATGGGACAAACCTCTGCCAGAGTGTATCGTGGTGGACTG
TGGGCATCCTGGATCTCCTCCTAATGGGCTGCTGAGCGGG
GATAAATTCACCTTCGGAGCCACGGTGCGATACAGCTGTA
CGGGTGGCCGGCAACTGAAGGGCGAATCCTCCAGGACGTG
CCAGCTCAACGGCCACTGGAGCGCACCCATGCCCTTTTGC
TCAGGTGATTCTTCTGGGACGTGTGGTGACCCGGGCACAC
CGTCCCACGGCAGCAGAGACGAGAGTGACTTTCGGATACG
AAGCAAAGTGCACTTCAGCTGCTCGGTGGGATACGAGCTT
TTCGGCTCCGTGGAAAGGATGTGTTTCCCAAACGGCACGT
GGTCCGGGACGCAACCCTCCTGCAAACCGGTGCAGTGTGG
AAACCCTGGGACTCCCAGTAATGGACGGGTGTATCGACTG
GACGGCACCACCTTTTCACACTCTGTCATCTACTCATGCA
TGGATGGATACCTGCTGAGCGGCTCGACCACGCGACAGTG
CCAAGCGAACGGTACCTGGTCTGGCACTGCACCAAACTGC
ACCTTGATCAACTGTGGAGAGCCAGGAGTGCCGGCCAATG
GACTGAGATACGGTGAAGACTTTACCATTGCGCAAAACAT
CACTTTTATGTGTCAGCCCGGCTACACCATGGAGGCCGAG
AGCTTCTCCACCATCACATGTACTGGAAATGGTACCTGGA
ACGCCCCTGTGCCTTTCTGTAAAGCCGTGACCTGCACCGC
TCCTCCACCCATCTCCAATGGCCTGCTGGAGGGCCGTGAC
TTTGAATGGGGCACCAGTGTGAGCTACAGCTGCTCCCCAG
GATACGAGCTCTCTTTCCCTGCCATCCTCACCTGTGTGGG
CAACGGTACATGGAGCGGAGAGGTGCCCCAGTGCCTGCCT
AAGTTCTGTGGAGATCCCGGAACCCCAGCGTTTGGCTCGA
GGGAAGGCCGCAGCTTCATCTACCAATCCGAGGTGTCATT
CAGCTGCATGGCTCCCTACATCCCAGTGGGCAGCACCACA
CGCATCTGCCAGACTGATGGCACCTGGAGCGGATCCCAGC
CCCGCTGTATAGAGCCGACTCGCACCACCTGTGAGAATCC
TGGGACGCCCCGTTACGGCTCTCTCAACAGGACTTTTGGC
TTTAAGGTTGGGAGTATGGTGGCTTTCCAGTGTCAGCCGG
GTCACCTTCTGCAGGGCTCCACCACACGCCTCTGTCAGGC
CGATCTCACCTGGAGCGGGACCCAGCCGGAGTGTATCCCC
CACAGTTGTAAACAGCCGGAGAGTCCTCCCCATGTGGACG
TTGTGGGAATGGATCTACCTTCCTATGGTTATACGCTCAT
CTACAGCTGTCAGAGCGGCTTCTTTCTGTCTGGTGGCTCT
GAACACCGCGTCTGCAGATCTGACGGGACGTGGACCGGGA
AGATGCCTGTGTGTCGAGGTAGCGAACACATCCCATTGTG
CTTTAAAAAGCGTTCAGTCATTCAACTCAAACTTTGCACA
CATGAAGCAACTATAGCGGGCTCCAAGCTCTCCGAAAAGC
CTATTAAACCGGTCCCAGGAACGCCGAGTCCGAAGCTAAA
CGTTCCTGATGATGTATTTGCCCCGAACTACATCTGGAAG
GGCTCGTACAACTACAAGGGAAGAAAGCAACCAATGACTT
TGAGTATCACAAGCTTTAATACAACCACGGGTAGAGTTAA
CGTCACATTAACAAGCAGCAACATGGAACTACTGCTTTCA
GGTGTCTATAAGAGCCAGGAAGCTCGTCTGATGCTGCTGG
TGTATCATGTGAAAGCCTCCTCATCCTCCACACTCAGCAA
GATCAAAGAAGAGCACTGGACCCTCGACGGATTTGTGTCT
GCTGAACCTGATGGCTCCACATATGTCTTTCAAGGCTTTA
TACAGGGTAAAGACTACGGCCAGTTTGGCCTGCAAAGGCT
AGGTTTGAATATGTCGGAGAGTAATAATTCGTCGAATCCA
CCACATGGTACAAACAGTAGCTCTGTGGCCATAGCAATCC
TTGTGCCTTTTTTCGCCCTGATATTTGCAGGCTTCGGATT
TTATCTCTACAAGCAGCGGACTACTCCAAAAACCCAGTAC
ACAGGCTGTTCAGTGCACGAAAACAACAACGGGCAGGCCG
CCTTCGAAAACCCCATGTACAACACCAAGCCCGAAGTAAA
AAACGTCCGTTTCGACCCCAATCTGAACACAGTCTGCACA
ATGGTATAATTGGGGATGTGAACACGTGGATTTATTTTTG
GTTTTGGTTTTTATTTAAGGGTATTTTTAGCTTCTTTTTT
TAAATCGGAGGTGGATACAATCGCATTACAGTCATAGACG
GATTTGTCTGAGACTCGCAGAGGATTTTAGCACAAACACT
GTTGCCCTTCCTCTGATATATAAAGCACACTCTTCAGGAA
CCAGTTGACCGAGGACATGTACGAAATATCAGACACATTG
TCATGAGGGAGATCTTTTGGTTTTTGTTGGGGTTTTTTTT
TTGTTGAAAGACTCGCTCTGAAAAGCTTCTTCATGACGGA
AGGCATGGAGAAAACCTTCGGCTACTTTATTCACACTCTG
TGAGTGCTTCTTCTTCTTCTTCACAGTTGACTGGGTATTT
TTTTAGGGGAAAGGGATCTGTAAATCTACTTGCATATATA
TGAGGAGCGTTCACCACCTATATTTTTGTGCTATATATTA
CCACATGGGAGAGGCCACGAGAGAACGATTCTAACAAGAG
TTTATAAAGAGATTCACGTCGACCTTTTGTTTTATTTACA
GCTTACATTCCTTTAGCTTTAGTTCTTAAAGAGATAGTAC
GCCTGATGTTGAAATTTACAGTTGAAGCCGGAATTATTAG
GCCCCTTTGAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations