ZFIN ID: ZDB-TSCRIPT-120213-764
Transcript Name: si:ch211-173n18.3-201
Previous Names: ch211-173n18.3-001, si:ch211-173n18.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054840 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054840|OTTDARG00000038272|ZDB-GENE-120215-62 si:ch211-173n18.3|OTTDARP00000043022 CH211-173N18.3-001 LG_ CR388364.11 Danio rerio protein_coding NOVEL, 938 bp
AACATTGTTTAGGTTTGGTAGTTTTTCATAAAAATGTCGC
GTTTTATGGACGCGTGCGCTCTTTCGTTTAAAGTCCTCAT
TCTCCCGTTGTACATCGCGGAGCATGTCGGACTTTTGTCT
TTCTTCAAACGCGTATTTCCTATGATTCAATATAAAGCCA
CGGACTGGTACAATAACAAGATGAATGACAAGAAACGGGA
ACTATTTCGAAACCTGGAGCGATTTCAGCCCCCCGAAGGC
TCTCTGCGCATCCTGGAGGTGGGCTGTGGATCAGGGGCGA
ACTTTGAGCACTACCCGACGGGCTCCAAGATCACCTGCAC
TGACCCTAACCCGCATTTCAAGAAATACCTGGAGAAAAGT
ATAGAGAAAAACGAGCACCTGGAGTACGACAACTTCATAG
TGGCGTCGGGGGAGAATCTGCAGGCAGTGGAGGACAGCTC
GGTGGATGCTGTGGTTTGCACTCTGGTTCTGTGCTCGGTC
AAAGACACCAACAAAGTTCTGCAAGAGTCAAAGAGGGTCC
TGAGACCTGGAGGAGCACTTTTCTTTCTTGAGCACGTGGT
GTCAGACCCTTCAACCTGGGCTTACTTTTTTCAGCATGTC
CTTGAGCCATTATGGTACTTCTTTGGCGATGGCTGTGAAG
TAACCCGTGCTACATGGAAGCACATTGAGGCCGCTGGATT
TTCAGATGTAAAGTTACACCACATTCAAGCTCCTCTGTTT
TTCATGCTCAAACCACACATCGTTGGTTATGCAGTCAAGT
AATGAATATGAATTTTGCCAGATCAGGTCTGATTTATTTT
ACCATTCACTAATAATGTGTTTTTATGAAAGAGCAATTTG
TAATACACCATAAAGTTTACAGTGCACATTAGTGATTACT
TAATCTCAAGATAAGATAGCAATGTAGATTTAATGTAACT
GCATTTTTTTGCACAAGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173n18.3-201 Contained in:
[BAC] CH211-173N18 (1)

Genome Resources: Vega_Trans:OTTDART00000054840 (1),  Ensembl_Trans:ENSDART00000036057 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124484 (1) 1863 nt
GenBank:EH484272 (1) 1002 nt
GenBank:CK398638 (1) 863 nt
GenBank:CF348518 (1) 777 nt
CITATIONS (2)