Transcript

si:dkey-43k4.5-201

ID
ZDB-TSCRIPT-120213-743
Name
si:dkey-43k4.5-201
Previous Names
  • dkey-43k4.5-001
  • si:dkey-43k4.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054656 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054656|OTTDARG00000038145|ZDB-GENE-120215-82 si:dkey-43k4.5|OTTDARP00000042912 DKEY-43K4.5-001 LG_none BX936371.21,BX936388.10 Danio rerio protein_coding NOVEL, 1479 bp
GCATGTAGGTAAACCATGGTGAAGGAAAAAAACGCTTGGT
GGATTTTGGATCCTAAAGACCATCTGTTACACATCAATGT
GGGTGGCTTGAGAAACACTCTATGCTCAAGCATTCTGAAG
AAGTTTCCGGACACACGTCTAGGGCAACTTCTGTCTTGTG
ACTCTGAGGATGACATTCTACAGCTCTGTGATGACTTTGA
TGTTCAACGGAAAGAGTTTTACTTTGACCGTAACCCTGGC
CTTTTCCCTTATGTCCTGCACTTTTACCAGACTGGTAAGC
TGCACATTATGGAAGAGCTATGCATTTTTTCCTTCTCTCA
GGAAATTGAATACTGGGGCATAAGTGATTTTTTTCTAGAC
AGCTGCTGTAGTTACCGTTATCTTGATCGCAAACTGGAGA
GACATCACAAAAGCTGGGATGAAGAAAGTGATGTTAGCAG
TGTAGATACATCGGTTGATGAAATTTCTGATCTGAACAAA
GACATCGAGCACTTCCATGAAATGCGTTTTGGAAACATTC
GGAAGTGTCTGTGGCTAACACTGGAAAATCCCGGATATTC
AATCCCAAGCAAACTTTTCAGCTTGCTTTCCATTTGTGTG
GTGTTGATATCAATTGCTACCATGTGCATTAATAGCATTC
CAGAATACCAGAAATTCGATGAAAATGGTAATCTAATTGA
AGACCCAACTATGCATGTTTTAGAAGTGTTCTGCATCTGC
TGGTTTACCTTTGAAGTAGTAACACGTATGCTTCTTGCTC
CAAACCATCGTAAATTCTTCCTGCTACCACTTAATGTGAT
TGATATAATCTCAGTCATGCCAATTTACATCACAATCTTT
TTTGATATGCTCATTGGAAGCGAGTCTGAGCTGGGCAACT
TGGGAAAACTGGTCCAGGTGTTGCGGCTAATGAGAATCTT
CAGGGTGCTGAAGTTGGCCAGGCATTCAACAGGTTTAAGG
TCTCTGGGTGCTACATTACGGCACAGCTACAGAGAGGTTG
GGATCTTATTGCTCTACCTGGCAGTGGGTGTATCTGTGTT
CTCCGGAATGGCTTACACTGCAGAAAATGAGGAAGATGTT
GGTTTGGACACGATCCCAGCTTGCTGGTGGTGGGGGACAG
TTAGCATGACAACAGTGGGATATGGAGATGTGGTGCCAGT
GACAGTGGCGGGAAAGCTAGCAGCATCTGGCTGCATCCTT
GGTGGCACATTAGTTGTGGCGTTGCCCATCACCATCATTT
TCAACAAGTTTTCACATTTTTATCGCAAACAGAAAGCTCT
TGAGGCCTCAGTGAGAAACAACAACAACAAGAAGTTTGTA
ATGAGACAACAGAGAAATAGTGGAGACAGTGCAATACATG
GGCATATCCACTGCTTGGAGGATGAAGAGATGGATGAAGA
TGTGGATTTTGATACAGGAGTTGTCAACTTTTGCTATGAA
GACCATCCATTAACATATACAGTCCGATGTGTCCATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations