Transcript

march7-202

ID
ZDB-TSCRIPT-120213-719
Name
march7-202
Previous Names
  • march7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054518 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054518|OTTDARG00000038071|ZDB-GENE-080204-121 march7|OTTDARP00000042824 march7-001 LG_ AL929243.7 Danio rerio protein_coding KNOWN, 3224 bp
GGCGGGGCGTGTTTGCAACGCTGTCATTCACTGGCTGCTG
CTACTGTCAATCAATCGCGCGTTTCCTGTCGGTGTCCGCT
TACACATTAAACCACGTGACCCCCCCTATATCAACACACG
GACGCCATTAATATTAAAGGCAGAAGAGACGGAAAATCGG
AGGGTGCAGTTCAGAGATGGATTCGAAGTCTCGACGGTTT
CCGTTCGCTGTCTCCAGCTCTTCATCGCTGTCATCGCCCT
CCTCGCTCTCTTCCTCATCTTCTGCGCTCAGTGCGAGTCG
ACTCTATGGCAGAGGGAGCGTCTTGGGAAGAGATCGCTTT
AGCAGAGACGCTTCTGTCAAATTAGACTCTGACTATCAGG
GTTCCCGTCTGCTGAGCTCACCAAGAGTTTACAGTTCGAC
TGAGAGTCGTCATTCCAACTGGAAACTCTCTACTCCTGTT
ACTTCCTCCTCCTCTTCTTCTTCATCATGTGATCGATCAT
GGACAGAATCTAGCAGTGGGGACAGAGCCAGACTTACAGA
CTCTGAGAGAAGGCTGGGAACCTACTGCGGACTTCTTGGC
ACTTCCCAAGACAGCGAGTCTAAAAGAGCCAAACTTTCCT
ACACGAATAGAGAAGTTTATTCCAGATCCCCATCCACATC
TAAGCCTGCCACCTCTTACTCCACTCTAGGTTCTTCATGG
AAATCTAGCATTAGTCCTTTGTCAAGATCATCCTCTTCAT
CTTCATCCTCTTCGGTGTCCACTCAATCAGAGGGTCTGTG
GGCCCGCAGAGATTTGGAGAAGAGGGTGGATTCAGGACTG
TCCTCACTGGGGGAGTCCAGTTACCGGCCCAGTAGCCTGA
CATCTTCATTGTATCGTTCAGAACGTGTTGCTTCTACCTA
TGCACAAGGTGCTCGACCCAAAGATAGCCAGTACTCGTCC
CACAGAGAGAACAGTTCATCTAGTCGCCGCATCCCATCCG
AGTACATCCCCTCTCCTCTAGAGCGCAACTCCCAAAGGCT
AACCTCTGATTACCAGTCTAATTTATTCCCTCGGGATACA
CCACGCTCCAGTTCCACTAGAACCTCCACCTCTGTATCGG
ACACCTCCCACCATTCATCTTGGAGTTCCACCCCTTACAC
AGCTCTCTCTGCCTGTACCTCCAGCCCACCTTCCATTAGC
CCTGCTCCTACTCCACTGCCTGCTCAGAATACAGGAGAAT
CGGATGGTAGAGGAACAACCAGGCGTCTCCTATCCCGCCT
TTTCTCCCGACGCTCCAGTCAGGAGTCCAACTCCACTGCC
AGCACTGCCTCCGATTCAAGGTCCTACGACTCTAGCCCAG
ATGAAGCCCCGCCCACTGAAGCTCCTCCTCCAATTAGTAG
AGAGAATTTAGAAGCGGAGCTGAGGAACTCTGATCCCGCT
CAGGCGTTTTCGTTCCTGCGCAGACGTGGACCATCTCTTG
CACCCGTCCAGGAGAGCACTGATGTAGAGCCTGAACAGGA
GTCCCTCAGACCTCCAGCTGGCCTGTCCTGGCTCAACTGG
AACCGATGTACCCCACTGTTCTCCCGTCGCAGGAGGGAAG
GCCGTGATGAAAGCGCGCGCATGGACCCTCATCGTTCGCC
CCAGTTCTCCCTGGGTGACCGAGATGGTCGTAAAACACCT
GATCAGGGCACACATTGTGAAGATGATGATGATGAGGATG
ATGATGATGAGGATGAGTCCTCGGAGGGGGCTGCAGCAGG
ACCCTCTTCTGGAGCCTCTGCACTCTCTGCATCACTCCTG
CAGGATGGAGCCCATTTGGCAGGACGGAGCCACGGCATGG
GCAGGGGAATGAACAGCCCGCTTTTCCGTTTGCCTGAGAA
TGTGTTGATTGGTGTTGGAGTCGAGGGGAGGAGTCAAGCT
GATGAGCAGCCCAAAGACAAGCCTGCCCCATCCAGAGACC
CAGAGAGACTGCGAAAGATTCAGGAAAGCCTGCTGTTGGA
GGAATCTGATGAGGAGGAGGGTGATCTGTGCCGAATCTGT
CAGATGGGGGAGCAGTGGAGTTCCAACCCTCTGATCGAAC
CCTGCAAGTGCACAGGCAGCCTGCAGTATGTGCACCAGGA
CTGCATTAAGAAATGGCTCCGCTCCAAAATCAGCTCTGGT
TCTAACTTGGAGGCCATCACTACCTGTGAACTTTGTAAAG
AAAAACTGCACCTTAACATTGAAAACTTTGACATCAATGA
GCTCTACAGATCTCATGAAAGGTCAGAGTATGAGTTCATC
AGCTGTGGTCTGTACCTGGTGGTGCTCCTGCACTTGTGTG
AGCAGAGGTTTTCTGATGTCCTGGGCGCAGTCAATGATGC
TGGGTTTTTCAACTTGGCGAGAACTCTACACGAACACATG
GACAATCTTGAAAGTTCATATGCAGAATCTGATGAAGATG
AAGTGGAGGACAGCAGACCCTCCATTGACTTCTGTGACTT
GGAGGATGATGATGAAGAAGAGGAGGAGGAGGAGGAGGTT
TAATCGGGTGGCTGGGAGGAAGGAGGTGTGGCTTGGTGGT
CCATCTGCCAGGATTTAGCCAGTGTCTGATTGGCAGCATA
ACCACTGTTCTCAGCCTATCACAAGGCTTTCATAATATGC
AGATAAATCTACACATTTCTGGGAGCTGTTTGGATCCCAT
TATGATTATGATTTTTATTATTTTTTGCTTCAGAATACGG
CGAGCACTCTAAAGCTTTTTCAGTTGATGGAGGAAAAAAA
AAAGTCCGGTGAACTGTCGACCACCATGAGTGCTTTATTC
ATGCTTAGAAACTGGTTTGTGTAAAGTGAGGGTCTTTTTG
AAGATTCCCACTCTTACAGTGGTGCAGTTGAGAAACGTTC
ATTCGCTCCTTTTTATAGGGCTGCTTGAAAAGGAGACATT
TGGTCACTATGTCTTGATGATTTTTAAAAAAAATAATAAT
AATAATAAATGTCCTGTTTTTTGTTTTTATGTGATTAATA
CACTTGTTTTGTGGAGATATGGTGAGTGAGAAAATGTGGT
CACTTTTTTTCTTTCAAGACTTCCTTTACAGAGGACCTTT
TCCACTGTCTGTTTGTATGTTGTACATTGACAATGTAATT
CGCTTGAGTTATTACAATAAAATAGAGGTATATCTTTACC
TCACAAAAATCCTCTCTGTCTTCTTAAAGCTGATCCAATA
GATGATTGTTCACTTATTTCCACTAATAATTATTACACTA
TTACATTTTATTTGCATGGTTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations