Transcript

si:ch211-241a17.6-001

ID
ZDB-TSCRIPT-120213-697
Name
si:ch211-241a17.6-001
Previous Names
  • ch211-241a17.6-001
Transcript Type
ncRNA
Annotation Status
to be experimentally confirmed
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000054399 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054399|OTTDARG00000037993|ZDB-GENE-120215-177 si:ch211-241a17.6|no_translation CH211-241A17.6-001 LG_ AL953886.9 Danio rerio TEC none, 477 bp
CCTTTTTTTCTGATAGGGCGACACTGTGGCCCAGTGGCTA
GCACTGTTGCCTCATAGCAAGAACACCGCTGGTCCAACCT
CCTATCGGGCCTGTTGGCCTTTCTGTGCGGAGTTTCTATG
TTCTCCCCGTGTTTCCTTGGGTTTTTCTCCCGCCTTCCAA
AAACATACACCATAGCCAATCGACTAAACCAAATTATCAC
CCAAGACAACCTGAGTTTACACTTCTCACACGGTGACAAG
CAGGGGAGTTCTTGAGACCTACCTGAGCTCAAACTCCCCT
CTCGCCCTTCTATTCGGAGGGAGCCCCAGGCTCGAGGATA
TTACGAGCTCAGGGCTCTCTCCCGGGACAGCATGCTAATT
ACGCTTTATTGATTATCAGCTAAGTGTGAACTCTTGAAAT
ATGGATTTTTTAAATGCAGCGTTTATTTAAATATTGCAGT
AATTGCCATCCCAATAAATCCAAATGTGCTAAATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations