ZFIN ID: ZDB-TSCRIPT-120213-6
Transcript Name: pik3r5-201
Previous Names: pik3r5-001, ch73-203d16.1-001, si:ch73-203d16.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030750 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030750|OTTDARG00000023581|ZDB-GENE-030131-2308 pik3r5|OTTDARP00000025034 CH73-203D16.1-001 LG_none BX255899.5,CT027640.13 Danio rerio protein_coding NOVEL, 2823 bp
GCGCAGCAGAAGTGCTAAAAACTCCTGCTCCTGTTGTTGT
AGCCGTTTGTTCAGCGTGTCTATAGGCTGATTTCACCTGA
TGCTGAAGCATGTGCTAACATTTCAGCCTCTTTTCATCAG
AAGTGCTGGATTACACGGCAAGGACATCGGTTCTGTCTCA
CTGCGCACTCTGATAAAAGGCAAAGACATCATGGGGAGAG
GCTAACAACACCAGTTCCAGTGAAGATGCAGCACACATCG
TGCACAGAGGACCGGATCCAGCATGCTCTGGACAGATGCC
TCGATGGACTCCGGCCATCGGAAAACCTGTCACAGTCTTG
GAGCGCGGGCTGGTGTATGAACCGCTGGAGTCTAGAAGAG
CTGATTAAAAGAGACCCCGATAATTTTCTCATTCTGCTGC
AGCAAATTCTCAGAAAAGCCAGAGAGGTTCAGCAGGAGTG
TCATTATGAGCTTGTGGCCCCTTTGGCTCTCATGTTTGAG
TCCACACTACTGCAGATGCCTCTTTGTCCATCCAGTGAAA
AGGTTCTGACAGAGGCATGTGAAGTGTTTCATGGCTTTCT
AGCATGGCCTGAGCCCTACTGTAGTGTGTGTCGTAACCTG
CTCTCCACACTGCATCAAGAGCTTCGAGCTCCAGGGATTT
CGTACCACAGACTGGTAAGAGAGGAACAAGGCCTTGCCAC
CTCCAGTCAGCGTTCTAAGATCATTACGGTGTTCTTGATG
AACCCCACCGAGGTGCCCCCTGAGTTCCTGTCTGTGGCGG
AGCAGCTCAGTTCCATAGAGGTTTCACAGAGAGAGAGCTG
TGTTACGCTCATTAAACACAGCTATCAGTCAGTGCTCGGT
ACAAAATACCCACTACACACCATCAACAGTGCTCTACAGT
GCCTTAGCGATGATGAGTTGGCACAGATCATGTCCTCAGT
GAGTGACCTATTAGAGTCTGCAGCAGCCATGGTGGATATC
GCTAAAGCTCGAAAGCATGTTGAGGGTGGCCTGGAGGTAT
TGCGAGAAAAACTTGGCATACCATCCTCCAATGGGAAAAT
GTCAGATGGGGTTCTTCAGACGCTCGGCCTTCCAGCAGCA
AAATGCTACACCTTCCATTGGGACAAGGATAATTTTGATG
TTCTAAATGACATTCTAGACATTGAGTCTGAATTGACATT
ATCTCAAACGTCTGAGAGCATGGAGGAAGATGATGTGGAC
AATGTTGATGTGGAAGATGATGAATATGATGACTTGGAAG
ATGTTTGCACTGACTATCGGGCCTCTACGTTCTCCACTGT
CTCCTCTCTCTCCACGGCCTCTAAAGACTCCATGTTCTCC
ACACTGTCAGTTGCTTCTTCAGAATGTTCTCCCCTGTCAA
CGCTCTCATCTTCATCTCAAGCTTCGGGGACAGACAGTGA
CTTCTGTGAGGATTTAGAGGATGACAGTTCAAGCACAGTA
TCCCCGTCTAAGACCAAAAACAGTGGCCGACTTTCAAAGC
GCATCTCACGATTCTTTAAACCTCGCAGCAGCAACTCTCT
CTGTCGAGCCAAGAGCCTTGGCAGCCCGGAGGCTAAAGAA
TTAGTGGTGGCAGTCCGCTCTAAGAGATCCAATTCTCTAC
CCCAGCAGGTTCATCTACGTAGCTCTGACTTCGGGTTCCC
AGTAATACCCCTATCTCAGCTCCAATATGTTTGCTACAGA
AGGAGACCTATTCTGAGTACAGATGACGAAGAAGGGCCAA
CAGGGGCCACTTTGCTTAGAGTGGTGGTGTTTGGGGCAGA
TCATGTGGCAGGGAGGCTCGCCCGAGCCTATAGTAGTCTG
AGGAAAAGAGAAAGAGACTGTCCACACCTGACCAAAGCTT
TCAGGATGAAGTTTTTCTTTGTACCTGTGAGGAGGGATAC
AGCCCCAGTCAACTCGAGGAGGTCCTCTCTGCAGCTCTCA
GCAAGTCCACTGAAAACAGCCATCTCAACCACAGATCTCT
GTGTGAACAGGATGGAGGACAGCACTAATGACATTGCGAA
TCTGCTGGGAATGCTGGATCCCTGGTATGAGCGTAACACT
CTAAGCCTTATGGAACTTCCCGTCAATGTGGTGTGCCAGC
AAACATCAAAGATTGATTCAGACTTGTCTGAGGGCACTGG
TGAGGAACGTTTACCAATATTTGCAGACCTGGTGCTCTAT
TACTGCCGCCATGCTGCCCGTCCTGCACTCATTCAGCTCT
ATCAAGCAGAGTTCACACTAGCTGGAGGAGTAAGACGGAC
TGAAGTATTTATTCACTCTCTGGAACTGGGCCACACAGCT
GGTACAAGAGCAATCAAGGCCATGGGAGCTGCAAGTAAGA
GATTTGGCATTGATGGAGATCGTGAGGCTGTTCCTTTGTC
GCTGGAAATAACGTATAACAGAATACATATCAGTGGCAGA
AGTCAGAAGACAAGGACAGAGAAGTCCTGTACCTCTATAA
ACCTGCAAAAAGCCTGTAGGAATTCAGAGGAACTAGATTC
TAAAATGGAGTGTCTTCGTTTGACAATGACCGAAGTGTTG
AAGAGACAAAACTCTAAATCAAAGAAAGGCTACAATCAGC
AACTGACTACCACAGAGGTAAAAGTGGATAAGGTTCAGGT
TAGTGGAACTTGCAACACCACCTTCGCAGTTTGTCTGGAC
CAAGATGAGAAGAAAATTTTACAGAGTGTGATGAGGTGTG
AGGTGTCAGTGTGTTATAAGCCGGACAGTTCAACTGACTG
GACGAGAGGAAGAGTGTTTTCATCACAGACGCAGCTTCTT
CAGCCCACATTCTGCTCTCTGCTGTGTCTCCCTGTGGCCA
CTTTTAGCGGACCTCAACCCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pik3r5-201 Contained in:
OTHER pik3r5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030750 (1)
  • Ensembl_Trans:ENSDART00000166192 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI473716 (1) 562bp
    GenBank:AI626702 (1) 492bp
    GenBank:EB987797 (1) 306bp
    CITATIONS (2)